\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012153349:

Variant ID: vg1012153349 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 12153349
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


ATCGATTTGGCCGTCGATATGGCAGTGTTTAGTTCCAATTTTTTTTTTCAAACTACCAACTTTTCTATCATATCAAAACTTTTCTACACACATAAACTTT[C/T]
AACTTTTCCAGCGCATCGTTTCAATTTCAACCAAACTTCTAATTTTAACGTGATATCGTCGTTGAACGGCGCCGCCGCCGCGTTTCACGCGAAGACGGCC

Reverse complement sequence

GGCCGTCTTCGCGTGAAACGCGGCGGCGGCGCCGTTCAACGACGATATCACGTTAAAATTAGAAGTTTGGTTGAAATTGAAACGATGCGCTGGAAAAGTT[G/A]
AAAGTTTATGTGTGTAGAAAAGTTTTGATATGATAGAAAAGTTGGTAGTTTGAAAAAAAAAATTGGAACTAAACACTGCCATATCGACGGCCAAATCGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.80% 24.50% 7.58% 12.17% NA
All Indica  2759 41.20% 30.20% 10.11% 18.52% NA
All Japonica  1512 94.80% 1.00% 2.18% 1.98% NA
Aus  269 0.70% 77.00% 13.38% 8.92% NA
Indica I  595 67.70% 6.60% 9.08% 16.64% NA
Indica II  465 39.60% 35.10% 9.46% 15.91% NA
Indica III  913 29.70% 36.90% 12.16% 21.25% NA
Indica Intermediate  786 35.40% 37.40% 8.91% 18.32% NA
Temperate Japonica  767 98.70% 0.70% 0.39% 0.26% NA
Tropical Japonica  504 91.70% 0.20% 4.37% 3.77% NA
Japonica Intermediate  241 89.20% 3.70% 3.32% 3.73% NA
VI/Aromatic  96 13.50% 78.10% 3.12% 5.21% NA
Intermediate  90 57.80% 28.90% 7.78% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1012153349 C -> T LOC_Os10g23280.1 upstream_gene_variant ; 2361.0bp to feature; MODIFIER silent_mutation Average:85.997; most accessible tissue: Zhenshan97 flower, score: 94.41 N N N N
vg1012153349 C -> T LOC_Os10g23290.1 downstream_gene_variant ; 1188.0bp to feature; MODIFIER silent_mutation Average:85.997; most accessible tissue: Zhenshan97 flower, score: 94.41 N N N N
vg1012153349 C -> T LOC_Os10g23280-LOC_Os10g23290 intergenic_region ; MODIFIER silent_mutation Average:85.997; most accessible tissue: Zhenshan97 flower, score: 94.41 N N N N
vg1012153349 C -> DEL N N silent_mutation Average:85.997; most accessible tissue: Zhenshan97 flower, score: 94.41 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1012153349 C T 0.06 0.03 0.01 0.03 0.05 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1012153349 NA 8.32E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012153349 NA 3.07E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012153349 NA 8.35E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012153349 NA 3.36E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012153349 NA 6.95E-09 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012153349 NA 1.54E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012153349 NA 9.23E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012153349 NA 1.60E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012153349 NA 4.52E-14 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012153349 4.46E-07 4.46E-07 mr1891 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012153349 NA 1.24E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012153349 NA 1.62E-12 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012153349 NA 8.55E-06 mr1992 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012153349 NA 9.77E-06 mr1446_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251