\
| Variant ID: vg1012131910 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 12131910 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTGGGCTTATCTCCGCCACTTCTCAGTCGGGTGCCCCGCAATGAACCATGCTATACAAAAGGTAAAGCCGTTGCCCACGCTGGCTTGTGGTTGGCACGGT[A/T]
AATGTTTCACATCCGAAACTCATGAACCGGTCCTTAATTGTCATGAGCACGACCATCAAAACCATGTGCTCACAACCCACCATTATCAGGTTTTAGTTGA
TCAACTAAAACCTGATAATGGTGGGTTGTGAGCACATGGTTTTGATGGTCGTGCTCATGACAATTAAGGACCGGTTCATGAGTTTCGGATGTGAAACATT[T/A]
ACCGTGCCAACCACAAGCCAGCGTGGGCAACGGCTTTACCTTTTGTATAGCATGGTTCATTGCGGGGCACCCGACTGAGAAGTGGCGGAGATAAGCCCAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.50% | 0.70% | 37.03% | 30.79% | NA |
| All Indica | 2759 | 2.30% | 1.10% | 52.37% | 44.29% | NA |
| All Japonica | 1512 | 90.70% | 0.00% | 5.56% | 3.70% | NA |
| Aus | 269 | 2.60% | 0.40% | 56.88% | 40.15% | NA |
| Indica I | 595 | 1.70% | 1.00% | 31.93% | 65.38% | NA |
| Indica II | 465 | 2.40% | 1.10% | 56.34% | 40.22% | NA |
| Indica III | 913 | 1.90% | 1.30% | 64.40% | 32.42% | NA |
| Indica Intermediate | 786 | 3.20% | 0.80% | 51.53% | 44.53% | NA |
| Temperate Japonica | 767 | 97.30% | 0.00% | 1.04% | 1.69% | NA |
| Tropical Japonica | 504 | 85.30% | 0.00% | 11.11% | 3.57% | NA |
| Japonica Intermediate | 241 | 81.30% | 0.00% | 8.30% | 10.37% | NA |
| VI/Aromatic | 96 | 8.30% | 1.00% | 41.67% | 48.96% | NA |
| Intermediate | 90 | 42.20% | 2.20% | 31.11% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1012131910 | A -> T | LOC_Os10g23250.1 | upstream_gene_variant ; 733.0bp to feature; MODIFIER | silent_mutation | Average:17.297; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| vg1012131910 | A -> T | LOC_Os10g23240-LOC_Os10g23250 | intergenic_region ; MODIFIER | silent_mutation | Average:17.297; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| vg1012131910 | A -> DEL | N | N | silent_mutation | Average:17.297; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1012131910 | 7.36E-06 | NA | mr1127 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012131910 | NA | 2.90E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012131910 | NA | 1.54E-24 | mr1537 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012131910 | NA | 1.99E-09 | mr1578 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012131910 | NA | 9.98E-44 | mr1591 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012131910 | NA | 3.72E-11 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012131910 | NA | 1.27E-08 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012131910 | NA | 7.91E-11 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012131910 | NA | 1.84E-39 | mr1891 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012131910 | NA | 6.49E-32 | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |