\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012000043:

Variant ID: vg1012000043 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 12000043
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTATCCACTAATTATTTACTATCATAAAGCACACATCATAAAATAATATTTAATTTATAGCAAGCTCTCTAATCAGCCAACTATAATCAAATTTCATG[C/T]
ATGCCCTCTATTCTCAAAGGGCATAATGGACATTTCTAAGCAAATTAACATCTAAACTGACATAGACTTGATGGGAGGGGTACGCAAGGGTTCCAAACAA

Reverse complement sequence

TTGTTTGGAACCCTTGCGTACCCCTCCCATCAAGTCTATGTCAGTTTAGATGTTAATTTGCTTAGAAATGTCCATTATGCCCTTTGAGAATAGAGGGCAT[G/A]
CATGAAATTTGATTATAGTTGGCTGATTAGAGAGCTTGCTATAAATTAAATATTATTTTATGATGTGTGCTTTATGATAGTAAATAATTAGTGGATAGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.50% 8.90% 3.68% 19.85% NA
All Indica  2759 70.80% 10.50% 4.06% 14.57% NA
All Japonica  1512 72.00% 0.20% 1.98% 25.86% NA
Aus  269 13.00% 42.00% 5.20% 39.78% NA
Indica I  595 74.50% 1.30% 5.04% 19.16% NA
Indica II  465 43.00% 29.90% 7.53% 19.57% NA
Indica III  913 83.20% 6.00% 1.20% 9.53% NA
Indica Intermediate  786 70.10% 11.30% 4.58% 13.99% NA
Temperate Japonica  767 93.10% 0.00% 1.30% 5.61% NA
Tropical Japonica  504 54.60% 0.20% 2.18% 43.06% NA
Japonica Intermediate  241 41.10% 0.80% 3.73% 54.36% NA
VI/Aromatic  96 54.20% 6.20% 9.38% 30.21% NA
Intermediate  90 70.00% 10.00% 10.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1012000043 C -> T LOC_Os10g23004.1 upstream_gene_variant ; 3001.0bp to feature; MODIFIER silent_mutation Average:13.304; most accessible tissue: Callus, score: 23.526 N N N N
vg1012000043 C -> T LOC_Os10g23020.1 downstream_gene_variant ; 1338.0bp to feature; MODIFIER silent_mutation Average:13.304; most accessible tissue: Callus, score: 23.526 N N N N
vg1012000043 C -> T LOC_Os10g23004-LOC_Os10g23020 intergenic_region ; MODIFIER silent_mutation Average:13.304; most accessible tissue: Callus, score: 23.526 N N N N
vg1012000043 C -> DEL N N silent_mutation Average:13.304; most accessible tissue: Callus, score: 23.526 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1012000043 NA 6.20E-06 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 2.57E-09 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 2.11E-06 5.68E-10 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 1.04E-11 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 2.72E-10 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 2.77E-07 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 1.12E-06 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 4.99E-06 mr1525 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 1.81E-09 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 2.77E-07 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 1.18E-08 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 1.30E-06 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 9.98E-06 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 2.18E-06 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 1.83E-10 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 3.77E-09 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 5.16E-07 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 5.65E-11 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 6.28E-12 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 3.25E-08 5.66E-17 mr1062_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 9.81E-10 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 1.34E-06 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 2.68E-09 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 2.53E-09 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 5.29E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 8.05E-07 mr1525_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 4.54E-18 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 7.10E-10 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 8.87E-06 mr1726_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 1.17E-07 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 1.48E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012000043 NA 1.63E-15 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251