\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011999393:

Variant ID: vg1011999393 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 11999393
Reference Allele: GAAlternative Allele: CA,G
Primary Allele: GASecondary Allele: CA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTTGTACTAATAAGTTAGAGAATATTCCTTGTGTACACCTCAAAACTCTCTCAATCCCTTCTATGCACCTGAAAAATACCGAATCCCTTGTGTGCCCTT[GA/CA,G]
AAATTTGTTTGGAACCCTTGCGTACCCCTCCCGTCAAGTCTTTGTCAGTTTAGATGTTAATTTTCTTAGAAATGTCCATTATGCCCTTTGAGAATGGAGG

Reverse complement sequence

CCTCCATTCTCAAAGGGCATAATGGACATTTCTAAGAAAATTAACATCTAAACTGACAAAGACTTGACGGGAGGGGTACGCAAGGGTTCCAAACAAATTT[TC/TG,C]
AAGGGCACACAAGGGATTCGGTATTTTTCAGGTGCATAGAAGGGATTGAGAGAGTTTTGAGGTGTACACAAGGAATATTCTCTAACTTATTAGTACAACA

Allele Frequencies:

Populations Population SizeFrequency of GA(primary allele) Frequency of CA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.30% 8.80% 5.90% 19.64% G: 1.35%
All Indica  2759 65.70% 10.10% 7.65% 14.24% G: 2.25%
All Japonica  1512 71.60% 0.20% 2.25% 25.86% G: 0.07%
Aus  269 10.80% 43.50% 6.32% 39.41% NA
Indica I  595 72.30% 1.20% 7.39% 18.99% G: 0.17%
Indica II  465 38.30% 29.90% 12.69% 18.92% G: 0.22%
Indica III  913 75.60% 5.70% 4.82% 9.20% G: 4.71%
Indica Intermediate  786 65.50% 10.40% 8.14% 13.74% G: 2.16%
Temperate Japonica  767 93.20% 0.00% 1.17% 5.61% NA
Tropical Japonica  504 54.00% 0.20% 2.58% 43.06% G: 0.20%
Japonica Intermediate  241 39.80% 0.80% 4.98% 54.36% NA
VI/Aromatic  96 54.20% 6.20% 9.38% 30.21% NA
Intermediate  90 70.00% 10.00% 8.89% 10.00% G: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011999393 GA -> CA LOC_Os10g23004.1 upstream_gene_variant ; 2351.0bp to feature; MODIFIER silent_mutation Average:16.625; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg1011999393 GA -> CA LOC_Os10g23020.1 downstream_gene_variant ; 1988.0bp to feature; MODIFIER silent_mutation Average:16.625; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg1011999393 GA -> CA LOC_Os10g23004-LOC_Os10g23020 intergenic_region ; MODIFIER silent_mutation Average:16.625; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg1011999393 GA -> G LOC_Os10g23004.1 upstream_gene_variant ; 2352.0bp to feature; MODIFIER silent_mutation Average:16.625; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg1011999393 GA -> G LOC_Os10g23020.1 downstream_gene_variant ; 1987.0bp to feature; MODIFIER silent_mutation Average:16.625; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg1011999393 GA -> G LOC_Os10g23004-LOC_Os10g23020 intergenic_region ; MODIFIER silent_mutation Average:16.625; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg1011999393 GA -> DEL N N silent_mutation Average:16.625; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011999393 NA 3.86E-09 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 1.12E-06 2.92E-10 mr1062 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 1.72E-11 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 4.06E-10 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 2.22E-07 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 1.64E-06 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 5.24E-06 mr1525 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 2.52E-09 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 2.22E-07 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 1.04E-08 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 4.37E-07 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 3.66E-06 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 2.57E-10 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 4.97E-09 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 2.97E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 7.40E-07 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 8.87E-11 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 1.00E-11 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 5.85E-08 1.08E-16 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 1.20E-09 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 1.86E-06 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 3.28E-09 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 2.32E-09 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 9.16E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 1.32E-06 mr1525_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 3.38E-17 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 6.02E-10 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 9.45E-06 mr1726_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 2.20E-07 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 2.37E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393 NA 3.84E-15 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251