Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011999393:

Variant ID: vg1011999393 (JBrowse)	Variation Type: INDEL
Chromosome: chr10	Position: 11999393
Reference Allele: GA	Alternative Allele: CA,G
Primary Allele: GA	Secondary Allele: CA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTTGTACTAATAAGTTAGAGAATATTCCTTGTGTACACCTCAAAACTCTCTCAATCCCTTCTATGCACCTGAAAAATACCGAATCCCTTGTGTGCCCTT[GA/CA,G]
AAATTTGTTTGGAACCCTTGCGTACCCCTCCCGTCAAGTCTTTGTCAGTTTAGATGTTAATTTTCTTAGAAATGTCCATTATGCCCTTTGAGAATGGAGG

Reverse complement sequence

CCTCCATTCTCAAAGGGCATAATGGACATTTCTAAGAAAATTAACATCTAAACTGACAAAGACTTGACGGGAGGGGTACGCAAGGGTTCCAAACAAATTT[TC/TG,C]
AAGGGCACACAAGGGATTCGGTATTTTTCAGGTGCATAGAAGGGATTGAGAGAGTTTTGAGGTGTACACAAGGAATATTCTCTAACTTATTAGTACAACA

Allele Frequencies:

Populations	Population Size	Frequency of GA(primary allele)	Frequency of CA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.30%	8.80%	5.90%	19.64%	G: 1.35%
All Indica	2759	65.70%	10.10%	7.65%	14.24%	G: 2.25%
All Japonica	1512	71.60%	0.20%	2.25%	25.86%	G: 0.07%
Aus	269	10.80%	43.50%	6.32%	39.41%	NA
Indica I	595	72.30%	1.20%	7.39%	18.99%	G: 0.17%
Indica II	465	38.30%	29.90%	12.69%	18.92%	G: 0.22%
Indica III	913	75.60%	5.70%	4.82%	9.20%	G: 4.71%
Indica Intermediate	786	65.50%	10.40%	8.14%	13.74%	G: 2.16%
Temperate Japonica	767	93.20%	0.00%	1.17%	5.61%	NA
Tropical Japonica	504	54.00%	0.20%	2.58%	43.06%	G: 0.20%
Japonica Intermediate	241	39.80%	0.80%	4.98%	54.36%	NA
VI/Aromatic	96	54.20%	6.20%	9.38%	30.21%	NA
Intermediate	90	70.00%	10.00%	8.89%	10.00%	G: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1011999393	GA -> CA	LOC_Os10g23004.1	upstream_gene_variant ; 2351.0bp to feature; MODIFIER	silent_mutation	Average:16.625; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg1011999393	GA -> CA	LOC_Os10g23020.1	downstream_gene_variant ; 1988.0bp to feature; MODIFIER	silent_mutation	Average:16.625; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg1011999393	GA -> CA	LOC_Os10g23004-LOC_Os10g23020	intergenic_region ; MODIFIER	silent_mutation	Average:16.625; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg1011999393	GA -> G	LOC_Os10g23004.1	upstream_gene_variant ; 2352.0bp to feature; MODIFIER	silent_mutation	Average:16.625; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg1011999393	GA -> G	LOC_Os10g23020.1	downstream_gene_variant ; 1987.0bp to feature; MODIFIER	silent_mutation	Average:16.625; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg1011999393	GA -> G	LOC_Os10g23004-LOC_Os10g23020	intergenic_region ; MODIFIER	silent_mutation	Average:16.625; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg1011999393	GA -> DEL	N	N	silent_mutation	Average:16.625; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1011999393	NA	3.86E-09	mr1059	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	1.12E-06	2.92E-10	mr1062	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	1.72E-11	mr1143	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	4.06E-10	mr1167	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	2.22E-07	mr1415	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	1.64E-06	mr1525	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	5.24E-06	mr1525	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	2.52E-09	mr1535	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	2.22E-07	mr1567	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	1.04E-08	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	4.37E-07	mr1593	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	3.66E-06	mr1626	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	2.57E-10	mr1675	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	4.97E-09	mr1726	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	2.97E-08	mr1806	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	7.40E-07	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	8.87E-11	mr1969	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	1.00E-11	mr1995	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	5.85E-08	1.08E-16	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	1.20E-09	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	1.86E-06	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	3.28E-09	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	2.32E-09	mr1195_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	9.16E-06	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	1.32E-06	mr1525_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	3.38E-17	mr1715_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	6.02E-10	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	9.45E-06	mr1726_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	2.20E-07	mr1807_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	2.37E-07	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011999393	NA	3.84E-15	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251