\
| Variant ID: vg1011966171 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 11966171 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAAATATTGCATTTTTCAAGTTTGAAGGGGTTTCAGGAAAGATACTCCCTCCGATCTATTTCATATTATAAGTCGTCTTGATTTGTTTAAGTCAAACTTT[G/A]
TTAAGTTTGATCAAGTTTAAAAAAATTCGCAACATCTAAAATTTGAAATTAATTTTATTAAATCAATATTAATTGAATATATTTTGATAATATGTTTGTT
AACAAACATATTATCAAAATATATTCAATTAATATTGATTTAATAAAATTAATTTCAAATTTTAGATGTTGCGAATTTTTTTAAACTTGATCAAACTTAA[C/T]
AAAGTTTGACTTAAACAAATCAAGACGACTTATAATATGAAATAGATCGGAGGGAGTATCTTTCCTGAAACCCCTTCAAACTTGAAAAATGCAATATTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 99.60% | 0.30% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 98.70% | 0.80% | 0.53% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.40% | 1.60% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1011966171 | G -> A | LOC_Os10g22970.1 | upstream_gene_variant ; 3994.0bp to feature; MODIFIER | silent_mutation | Average:34.866; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg1011966171 | G -> A | LOC_Os10g22970-LOC_Os10g22980 | intergenic_region ; MODIFIER | silent_mutation | Average:34.866; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1011966171 | 9.45E-07 | NA | mr1089_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011966171 | 1.65E-07 | 5.47E-08 | mr1129_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011966171 | NA | 3.76E-06 | mr1204_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011966171 | 5.31E-06 | NA | mr1257_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011966171 | NA | 8.48E-06 | mr1318_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011966171 | 4.91E-06 | 4.91E-06 | mr1342_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011966171 | 7.16E-06 | 7.16E-06 | mr1357_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011966171 | NA | 5.87E-06 | mr1381_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011966171 | NA | 2.33E-06 | mr1457_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011966171 | NA | 1.51E-06 | mr1458_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011966171 | NA | 1.76E-07 | mr1735_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011966171 | 7.90E-06 | 7.90E-06 | mr1785_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011966171 | NA | 1.34E-06 | mr1874_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |