Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1011966171:

Variant ID: vg1011966171 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11966171
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAATATTGCATTTTTCAAGTTTGAAGGGGTTTCAGGAAAGATACTCCCTCCGATCTATTTCATATTATAAGTCGTCTTGATTTGTTTAAGTCAAACTTT[G/A]
TTAAGTTTGATCAAGTTTAAAAAAATTCGCAACATCTAAAATTTGAAATTAATTTTATTAAATCAATATTAATTGAATATATTTTGATAATATGTTTGTT

Reverse complement sequence

AACAAACATATTATCAAAATATATTCAATTAATATTGATTTAATAAAATTAATTTCAAATTTTAGATGTTGCGAATTTTTTTAAACTTGATCAAACTTAA[C/T]
AAAGTTTGACTTAAACAAATCAAGACGACTTATAATATGAAATAGATCGGAGGGAGTATCTTTCCTGAAACCCCTTCAAACTTGAAAAATGCAATATTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.60% 0.30% 0.17% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 98.70% 0.80% 0.53% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 97.40% 1.60% 1.04% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011966171 G -> A LOC_Os10g22970.1 upstream_gene_variant ; 3994.0bp to feature; MODIFIER silent_mutation Average:34.866; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg1011966171 G -> A LOC_Os10g22970-LOC_Os10g22980 intergenic_region ; MODIFIER silent_mutation Average:34.866; most accessible tissue: Minghui63 root, score: 43.505 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011966171 9.45E-07 NA mr1089_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011966171 1.65E-07 5.47E-08 mr1129_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011966171 NA 3.76E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011966171 5.31E-06 NA mr1257_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011966171 NA 8.48E-06 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011966171 4.91E-06 4.91E-06 mr1342_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011966171 7.16E-06 7.16E-06 mr1357_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011966171 NA 5.87E-06 mr1381_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011966171 NA 2.33E-06 mr1457_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011966171 NA 1.51E-06 mr1458_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011966171 NA 1.76E-07 mr1735_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011966171 7.90E-06 7.90E-06 mr1785_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011966171 NA 1.34E-06 mr1874_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251