| Variant ID: vg1011932223 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 11932223 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAAAAGCTTCAGATATGTGTCTGATTGCAACAACTGAAAAAAAAGGATTGCAAGAGACAAATGATCTAGTTATTTTCCTCTAAAATATAGGATCGAATCA[C/T]
AAGAACTAAGCCAACCAGAGGGGGAGTGAATGGTTGGTATACCCAAAAACCGAAAACTTTTAGCGGAAATAAAAGTTACCCTTGAAATCGATGGATCGCA
TGCGATCCATCGATTTCAAGGGTAACTTTTATTTCCGCTAAAAGTTTTCGGTTTTTGGGTATACCAACCATTCACTCCCCCTCTGGTTGGCTTAGTTCTT[G/A]
TGATTCGATCCTATATTTTAGAGGAAAATAACTAGATCATTTGTCTCTTGCAATCCTTTTTTTTCAGTTGTTGCAATCAGACACATATCTGAAGCTTTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.90% | 9.90% | 0.17% | 0.08% | NA |
| All Indica | 2759 | 95.10% | 4.70% | 0.11% | 0.11% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 9.30% | 88.50% | 1.86% | 0.37% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 91.60% | 8.20% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 93.10% | 6.50% | 0.00% | 0.38% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 20.80% | 79.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1011932223 | C -> T | LOC_Os10g22950.1 | upstream_gene_variant ; 3403.0bp to feature; MODIFIER | silent_mutation | Average:56.487; most accessible tissue: Zhenshan97 root, score: 66.982 | N | N | N | N |
| vg1011932223 | C -> T | LOC_Os10g22940.1 | intron_variant ; MODIFIER | silent_mutation | Average:56.487; most accessible tissue: Zhenshan97 root, score: 66.982 | N | N | N | N |
| vg1011932223 | C -> DEL | N | N | silent_mutation | Average:56.487; most accessible tissue: Zhenshan97 root, score: 66.982 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1011932223 | NA | 1.32E-06 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011932223 | NA | 2.43E-07 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011932223 | NA | 1.90E-07 | mr1415 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011932223 | NA | 5.55E-07 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011932223 | NA | 1.90E-07 | mr1567 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011932223 | 7.63E-07 | NA | mr1208_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011932223 | 3.30E-06 | NA | mr1795_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011932223 | NA | 7.82E-09 | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |