\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011932223:

Variant ID: vg1011932223 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11932223
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAAAGCTTCAGATATGTGTCTGATTGCAACAACTGAAAAAAAAGGATTGCAAGAGACAAATGATCTAGTTATTTTCCTCTAAAATATAGGATCGAATCA[C/T]
AAGAACTAAGCCAACCAGAGGGGGAGTGAATGGTTGGTATACCCAAAAACCGAAAACTTTTAGCGGAAATAAAAGTTACCCTTGAAATCGATGGATCGCA

Reverse complement sequence

TGCGATCCATCGATTTCAAGGGTAACTTTTATTTCCGCTAAAAGTTTTCGGTTTTTGGGTATACCAACCATTCACTCCCCCTCTGGTTGGCTTAGTTCTT[G/A]
TGATTCGATCCTATATTTTAGAGGAAAATAACTAGATCATTTGTCTCTTGCAATCCTTTTTTTTCAGTTGTTGCAATCAGACACATATCTGAAGCTTTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.90% 9.90% 0.17% 0.08% NA
All Indica  2759 95.10% 4.70% 0.11% 0.11% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 9.30% 88.50% 1.86% 0.37% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 0.90% 0.22% 0.00% NA
Indica III  913 91.60% 8.20% 0.22% 0.00% NA
Indica Intermediate  786 93.10% 6.50% 0.00% 0.38% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 20.80% 79.20% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011932223 C -> T LOC_Os10g22950.1 upstream_gene_variant ; 3403.0bp to feature; MODIFIER silent_mutation Average:56.487; most accessible tissue: Zhenshan97 root, score: 66.982 N N N N
vg1011932223 C -> T LOC_Os10g22940.1 intron_variant ; MODIFIER silent_mutation Average:56.487; most accessible tissue: Zhenshan97 root, score: 66.982 N N N N
vg1011932223 C -> DEL N N silent_mutation Average:56.487; most accessible tissue: Zhenshan97 root, score: 66.982 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011932223 NA 1.32E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011932223 NA 2.43E-07 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011932223 NA 1.90E-07 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011932223 NA 5.55E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011932223 NA 1.90E-07 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011932223 7.63E-07 NA mr1208_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011932223 3.30E-06 NA mr1795_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011932223 NA 7.82E-09 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251