Variant ID: vg1011931840 (JBrowse) | Variation Type: SNP |
Chromosome: chr10 | Position: 11931840 |
Reference Allele: A | Alternative Allele: T |
Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 245. )
TTTGATGATAAGACGTTAACATGAGCATCAATCGATTATCGCTTACCTTAGGAGGTTTGACTGCTATGGGAACTATTAATTCCTTGCGCCCCAAAATATA[A/T]
AGGATTTTGGGTGGAGTGATACATCCTGATACAATTAAATATAAGATAATACATCTCCATCAATACATTATATTTGGGGACGGAAGAAGTATAAAATAGG
CCTATTTTATACTTCTTCCGTCCCCAAATATAATGTATTGATGGAGATGTATTATCTTATATTTAATTGTATCAGGATGTATCACTCCACCCAAAATCCT[T/A]
TATATTTTGGGGCGCAAGGAATTAATAGTTCCCATAGCAGTCAAACCTCCTAAGGTAAGCGATAATCGATTGATGCTCATGTTAACGTCTTATCATCAAA
Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 98.10% | 1.10% | 0.76% | 0.00% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 94.20% | 3.50% | 2.31% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 88.70% | 6.80% | 4.56% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1011931840 | A -> T | LOC_Os10g22940.1 | synonymous_variant ; p.Leu132Leu; LOW | synonymous_codon | Average:66.226; most accessible tissue: Minghui63 root, score: 77.832 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1011931840 | NA | 9.90E-10 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg1011931840 | 3.34E-06 | 3.34E-06 | mr1343 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1011931840 | 2.63E-06 | 2.39E-11 | mr1354 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1011931840 | NA | 6.96E-08 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1011931840 | NA | 9.10E-08 | mr1902 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1011931840 | NA | 5.93E-12 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1011931840 | NA | 1.09E-07 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1011931840 | NA | 7.16E-10 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |