\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011874516:

Variant ID: vg1011874516 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11874516
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


TCTAAACCATAATTAGATCGCCCTGGAAACAATGAAATCTATGTACTAAACTACCAATCTCAAAAAAATAGAATGATATTCATGTACTAAAATCGATCAG[G/A]
ACAAAGAATGAAATCAATGTACAACAAGTTGTTGGGGAAATCCGTCGTGTGTTGCACTGTATAGCTAATTCTTTTAAAGCAAAACAGCCATTCAATAGAT

Reverse complement sequence

ATCTATTGAATGGCTGTTTTGCTTTAAAAGAATTAGCTATACAGTGCAACACACGACGGATTTCCCCAACAACTTGTTGTACATTGATTTCATTCTTTGT[C/T]
CTGATCGATTTTAGTACATGAATATCATTCTATTTTTTTGAGATTGGTAGTTTAGTACATAGATTTCATTGTTTCCAGGGCGATCTAATTATGGTTTAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.10% 0.30% 0.55% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 97.40% 0.90% 1.72% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 94.80% 1.80% 3.39% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011874516 G -> A LOC_Os10g22840.1 upstream_gene_variant ; 4459.0bp to feature; MODIFIER silent_mutation Average:46.982; most accessible tissue: Callus, score: 72.451 N N N N
vg1011874516 G -> A LOC_Os10g22850.1 upstream_gene_variant ; 2084.0bp to feature; MODIFIER silent_mutation Average:46.982; most accessible tissue: Callus, score: 72.451 N N N N
vg1011874516 G -> A LOC_Os10g22869.3 downstream_gene_variant ; 4128.0bp to feature; MODIFIER silent_mutation Average:46.982; most accessible tissue: Callus, score: 72.451 N N N N
vg1011874516 G -> A LOC_Os10g22840-LOC_Os10g22850 intergenic_region ; MODIFIER silent_mutation Average:46.982; most accessible tissue: Callus, score: 72.451 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011874516 NA 7.86E-06 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011874516 9.21E-06 9.20E-06 mr1081_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011874516 7.42E-06 NA mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011874516 3.76E-07 2.02E-07 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011874516 NA 5.71E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011874516 NA 3.26E-06 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011874516 5.93E-06 5.93E-06 mr1342_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011874516 7.42E-06 7.42E-06 mr1356_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011874516 4.02E-06 4.02E-06 mr1357_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011874516 NA 6.34E-06 mr1381_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011874516 6.35E-06 6.35E-06 mr1432_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011874516 NA 1.90E-06 mr1457_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011874516 NA 3.60E-07 mr1458_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011874516 NA 1.96E-07 mr1735_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011874516 NA 3.77E-07 mr1874_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251