\
| Variant ID: vg1011859779 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 11859779 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 122. )
TTACAATTGTCTTCGTTTTCTTTTCAATTTGACTTTGCCATGTACTATTCATAGGTGATAAGGATGGCTAGATCTCATCCCAGTGGACTACCACATTGCT[T/G]
GTTAAATAGATTTTTCTATTATGACCGCGGTCATCGTGCTCTCACTGGTGCGAATTAAATCAATATTCTATCCTGTAATGCTTTGCCTTTTTTCAATTAT
ATAATTGAAAAAAGGCAAAGCATTACAGGATAGAATATTGATTTAATTCGCACCAGTGAGAGCACGATGACCGCGGTCATAATAGAAAAATCTATTTAAC[A/C]
AGCAATGTGGTAGTCCACTGGGATGAGATCTAGCCATCCTTATCACCTATGAATAGTACATGGCAAAGTCAAATTGAAAAGAAAACGAAGACAATTGTAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.10% | 19.90% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 80.40% | 19.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 76.00% | 23.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 61.30% | 38.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 79.10% | 20.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 81.70% | 18.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 60.70% | 39.10% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 56.40% | 43.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1011859779 | T -> G | LOC_Os10g22820.1 | upstream_gene_variant ; 630.0bp to feature; MODIFIER | silent_mutation | Average:52.944; most accessible tissue: Callus, score: 86.137 | N | N | N | N |
| vg1011859779 | T -> G | LOC_Os10g22810.1 | downstream_gene_variant ; 4325.0bp to feature; MODIFIER | silent_mutation | Average:52.944; most accessible tissue: Callus, score: 86.137 | N | N | N | N |
| vg1011859779 | T -> G | LOC_Os10g22830.1 | downstream_gene_variant ; 4168.0bp to feature; MODIFIER | silent_mutation | Average:52.944; most accessible tissue: Callus, score: 86.137 | N | N | N | N |
| vg1011859779 | T -> G | LOC_Os10g22810-LOC_Os10g22820 | intergenic_region ; MODIFIER | silent_mutation | Average:52.944; most accessible tissue: Callus, score: 86.137 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1011859779 | NA | 6.77E-06 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011859779 | NA | 1.79E-06 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011859779 | NA | 9.32E-07 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011859779 | NA | 3.53E-06 | mr1123_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011859779 | NA | 4.66E-06 | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011859779 | NA | 1.63E-12 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011859779 | 2.37E-06 | NA | mr1613_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011859779 | NA | 1.53E-11 | mr1794_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011859779 | 2.93E-06 | NA | mr1962_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |