Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011859779:

Variant ID: vg1011859779 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 11859779
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

TTACAATTGTCTTCGTTTTCTTTTCAATTTGACTTTGCCATGTACTATTCATAGGTGATAAGGATGGCTAGATCTCATCCCAGTGGACTACCACATTGCT[T/G]
GTTAAATAGATTTTTCTATTATGACCGCGGTCATCGTGCTCTCACTGGTGCGAATTAAATCAATATTCTATCCTGTAATGCTTTGCCTTTTTTCAATTAT

Reverse complement sequence

ATAATTGAAAAAAGGCAAAGCATTACAGGATAGAATATTGATTTAATTCGCACCAGTGAGAGCACGATGACCGCGGTCATAATAGAAAAATCTATTTAAC[A/C]
AGCAATGTGGTAGTCCACTGGGATGAGATCTAGCCATCCTTATCACCTATGAATAGTACATGGCAAAGTCAAATTGAAAAGAAAACGAAGACAATTGTAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.10%	19.90%	0.02%	0.00%	NA
All Indica	2759	80.40%	19.60%	0.00%	0.00%	NA
All Japonica	1512	76.00%	23.90%	0.07%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	95.50%	4.50%	0.00%	0.00%	NA
Indica II	465	61.30%	38.70%	0.00%	0.00%	NA
Indica III	913	79.10%	20.90%	0.00%	0.00%	NA
Indica Intermediate	786	81.70%	18.30%	0.00%	0.00%	NA
Temperate Japonica	767	92.20%	7.80%	0.00%	0.00%	NA
Tropical Japonica	504	60.70%	39.10%	0.20%	0.00%	NA
Japonica Intermediate	241	56.40%	43.60%	0.00%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	76.70%	23.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1011859779	T -> G	LOC_Os10g22820.1	upstream_gene_variant ; 630.0bp to feature; MODIFIER	silent_mutation	Average:52.944; most accessible tissue: Callus, score: 86.137	N	N	N	N
vg1011859779	T -> G	LOC_Os10g22810.1	downstream_gene_variant ; 4325.0bp to feature; MODIFIER	silent_mutation	Average:52.944; most accessible tissue: Callus, score: 86.137	N	N	N	N
vg1011859779	T -> G	LOC_Os10g22830.1	downstream_gene_variant ; 4168.0bp to feature; MODIFIER	silent_mutation	Average:52.944; most accessible tissue: Callus, score: 86.137	N	N	N	N
vg1011859779	T -> G	LOC_Os10g22810-LOC_Os10g22820	intergenic_region ; MODIFIER	silent_mutation	Average:52.944; most accessible tissue: Callus, score: 86.137	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1011859779	NA	6.77E-06	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011859779	NA	1.79E-06	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011859779	NA	9.32E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011859779	NA	3.53E-06	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011859779	NA	4.66E-06	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011859779	NA	1.63E-12	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011859779	2.37E-06	NA	mr1613_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011859779	NA	1.53E-11	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011859779	2.93E-06	NA	mr1962_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251