\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011859779:

Variant ID: vg1011859779 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11859779
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


TTACAATTGTCTTCGTTTTCTTTTCAATTTGACTTTGCCATGTACTATTCATAGGTGATAAGGATGGCTAGATCTCATCCCAGTGGACTACCACATTGCT[T/G]
GTTAAATAGATTTTTCTATTATGACCGCGGTCATCGTGCTCTCACTGGTGCGAATTAAATCAATATTCTATCCTGTAATGCTTTGCCTTTTTTCAATTAT

Reverse complement sequence

ATAATTGAAAAAAGGCAAAGCATTACAGGATAGAATATTGATTTAATTCGCACCAGTGAGAGCACGATGACCGCGGTCATAATAGAAAAATCTATTTAAC[A/C]
AGCAATGTGGTAGTCCACTGGGATGAGATCTAGCCATCCTTATCACCTATGAATAGTACATGGCAAAGTCAAATTGAAAAGAAAACGAAGACAATTGTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.10% 19.90% 0.02% 0.00% NA
All Indica  2759 80.40% 19.60% 0.00% 0.00% NA
All Japonica  1512 76.00% 23.90% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 95.50% 4.50% 0.00% 0.00% NA
Indica II  465 61.30% 38.70% 0.00% 0.00% NA
Indica III  913 79.10% 20.90% 0.00% 0.00% NA
Indica Intermediate  786 81.70% 18.30% 0.00% 0.00% NA
Temperate Japonica  767 92.20% 7.80% 0.00% 0.00% NA
Tropical Japonica  504 60.70% 39.10% 0.20% 0.00% NA
Japonica Intermediate  241 56.40% 43.60% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011859779 T -> G LOC_Os10g22820.1 upstream_gene_variant ; 630.0bp to feature; MODIFIER silent_mutation Average:52.944; most accessible tissue: Callus, score: 86.137 N N N N
vg1011859779 T -> G LOC_Os10g22810.1 downstream_gene_variant ; 4325.0bp to feature; MODIFIER silent_mutation Average:52.944; most accessible tissue: Callus, score: 86.137 N N N N
vg1011859779 T -> G LOC_Os10g22830.1 downstream_gene_variant ; 4168.0bp to feature; MODIFIER silent_mutation Average:52.944; most accessible tissue: Callus, score: 86.137 N N N N
vg1011859779 T -> G LOC_Os10g22810-LOC_Os10g22820 intergenic_region ; MODIFIER silent_mutation Average:52.944; most accessible tissue: Callus, score: 86.137 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011859779 NA 6.77E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011859779 NA 1.79E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011859779 NA 9.32E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011859779 NA 3.53E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011859779 NA 4.66E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011859779 NA 1.63E-12 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011859779 2.37E-06 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011859779 NA 1.53E-11 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011859779 2.93E-06 NA mr1962_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251