Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011829118:

Variant ID: vg1011829118 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 11829118
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:

GATAAGAAAACCGGTGGGATTTTACTCTTATCCTAACTAACCGGCATTAGTCGATAAAATCAACTAACATTCTCCTCTTGATTTTGAGACTAACTAACGA[G/A]
TTTACTAAATATAATAGCTTCCCAAGGCAATCTGTCACAACAACATTATGCGTTACTGAGACAATAAGACTTATTGTTCACTATAGTACCCAAATAAACT

Reverse complement sequence

AGTTTATTTGGGTACTATAGTGAACAATAAGTCTTATTGTCTCAGTAACGCATAATGTTGTTGTGACAGATTGCCTTGGGAAGCTATTATATTTAGTAAA[C/T]
TCGTTAGTTAGTCTCAAAATCAAGAGGAGAATGTTAGTTGATTTTATCGACTAATGCCGGTTAGTTAGGATAAGAGTAAAATCCCACCGGTTTTCTTATC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.70%	41.00%	3.51%	13.73%	NA
All Indica	2759	61.80%	21.60%	3.44%	13.12%	NA
All Japonica	1512	15.00%	84.10%	0.40%	0.53%	NA
Aus	269	5.60%	2.60%	17.84%	73.98%	NA
Indica I	595	52.80%	7.60%	5.88%	33.78%	NA
Indica II	465	54.40%	40.20%	1.51%	3.87%	NA
Indica III	913	69.10%	22.00%	1.86%	7.01%	NA
Indica Intermediate	786	64.50%	20.90%	4.58%	10.05%	NA
Temperate Japonica	767	4.40%	95.20%	0.13%	0.26%	NA
Tropical Japonica	504	26.40%	73.40%	0.00%	0.20%	NA
Japonica Intermediate	241	24.90%	71.00%	2.07%	2.07%	NA
VI/Aromatic	96	3.10%	18.80%	13.54%	64.58%	NA
Intermediate	90	25.60%	50.00%	4.44%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1011829118	G -> A	LOC_Os10g22760.1	upstream_gene_variant ; 609.0bp to feature; MODIFIER	silent_mutation	Average:35.212; most accessible tissue: Callus, score: 50.944	N	N	N	N
vg1011829118	G -> A	LOC_Os10g22750.1	downstream_gene_variant ; 2219.0bp to feature; MODIFIER	silent_mutation	Average:35.212; most accessible tissue: Callus, score: 50.944	N	N	N	N
vg1011829118	G -> A	LOC_Os10g22750-LOC_Os10g22760	intergenic_region ; MODIFIER	silent_mutation	Average:35.212; most accessible tissue: Callus, score: 50.944	N	N	N	N
vg1011829118	G -> DEL	N	N	silent_mutation	Average:35.212; most accessible tissue: Callus, score: 50.944	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1011829118	NA	3.04E-06	mr1182	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011829118	NA	6.18E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011829118	NA	4.17E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011829118	2.53E-06	6.56E-06	mr1019_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011829118	NA	1.72E-06	mr1098_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011829118	NA	2.45E-06	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011829118	NA	1.06E-06	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011829118	NA	6.52E-06	mr1332_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011829118	5.45E-07	NA	mr1495_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251