Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1011760237:

Variant ID: vg1011760237 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 11760237
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.55, T: 0.45, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:

CGTGCGGTCGACTTAAGAGGACCGCACGGAAAAATCAATTTTCGCGTGCGGGCATATTAAGTGGACCGCACGCGAAAATACATCTCCCTCTCACTCACTT[T/C]
AAAATTTTCACACCTCTCCCTCTTACTCACTTCAAAATTTTCACACATCTCCCTCTAACTCATTTCAATTTTTTCACACCTCCTCTCCCTTCCTTTTTGT

Reverse complement sequence

ACAAAAAGGAAGGGAGAGGAGGTGTGAAAAAATTGAAATGAGTTAGAGGGAGATGTGTGAAAATTTTGAAGTGAGTAAGAGGGAGAGGTGTGAAAATTTT[A/G]
AAGTGAGTGAGAGGGAGATGTATTTTCGCGTGCGGTCCACTTAATATGCCCGCACGCGAAAATTGATTTTTCCGTGCGGTCCTCTTAAGTCGACCGCACG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.80%	9.20%	0.02%	0.00%	NA
All Indica	2759	99.50%	0.50%	0.00%	0.00%	NA
All Japonica	1512	72.70%	27.20%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.50%	0.00%	0.00%	NA
Temperate Japonica	767	57.40%	42.50%	0.13%	0.00%	NA
Tropical Japonica	504	90.50%	9.50%	0.00%	0.00%	NA
Japonica Intermediate	241	84.20%	15.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1011760237	T -> C	LOC_Os10g22640.1	upstream_gene_variant ; 4767.0bp to feature; MODIFIER	silent_mutation	Average:66.861; most accessible tissue: Minghui63 young leaf, score: 82.907	N	N	N	N
vg1011760237	T -> C	LOC_Os10g22630.1	downstream_gene_variant ; 997.0bp to feature; MODIFIER	silent_mutation	Average:66.861; most accessible tissue: Minghui63 young leaf, score: 82.907	N	N	N	N
vg1011760237	T -> C	LOC_Os10g22630.2	downstream_gene_variant ; 1059.0bp to feature; MODIFIER	silent_mutation	Average:66.861; most accessible tissue: Minghui63 young leaf, score: 82.907	N	N	N	N
vg1011760237	T -> C	LOC_Os10g22630-LOC_Os10g22640	intergenic_region ; MODIFIER	silent_mutation	Average:66.861; most accessible tissue: Minghui63 young leaf, score: 82.907	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1011760237	NA	6.99E-06	mr1096	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011760237	1.06E-06	NA	mr1746	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251