| Variant ID: vg1011728450 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr10 | Position: 11728450 |
| Reference Allele: T | Alternative Allele: A,TAA,TA,TTA,TAAA |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.66, T: 0.34, others allele: 0.00, population size: 93. )
AATTTTAAAATCCCAATCATAAAATAAGTTTATAAAGTCTAATAAGTTCATGTTGTCATAATAGTGTTTTTAGGCAAATCTACGTATACAAGTTTTTTTT[T/A,TAA,TA,TTA,TAAA]
AAAAATATGCATTTAAAAAATTATTGATTATAAATGTTAAAACTTAAAGTCAATCCTGCGATAAAAATCAAATAACTTTTACCAGAGTAGTGCCCGACTA
TAGTCGGGCACTACTCTGGTAAAAGTTATTTGATTTTTATCGCAGGATTGACTTTAAGTTTTAACATTTATAATCAATAATTTTTTAAATGCATATTTTT[A/T,TTA,TA,TAA,TTTA]
AAAAAAAACTTGTATACGTAGATTTGCCTAAAAACACTATTATGACAACATGAACTTATTAGACTTTATAAACTTATTTTATGATTGGGATTTTAAAATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.40% | 32.60% | 0.83% | 0.00% | TA: 0.04%; TTA: 0.02%; TAA: 0.02%; TAAA: 0.02% |
| All Indica | 2759 | 65.50% | 33.90% | 0.51% | 0.00% | TA: 0.07% |
| All Japonica | 1512 | 60.00% | 38.60% | 1.39% | 0.00% | TTA: 0.07% |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 76.60% | 22.90% | 0.50% | 0.00% | NA |
| Indica II | 465 | 59.10% | 40.00% | 0.86% | 0.00% | NA |
| Indica III | 913 | 62.30% | 37.20% | 0.33% | 0.00% | TA: 0.11% |
| Indica Intermediate | 786 | 64.50% | 34.90% | 0.51% | 0.00% | TA: 0.13% |
| Temperate Japonica | 767 | 33.50% | 64.30% | 2.09% | 0.00% | TTA: 0.13% |
| Tropical Japonica | 504 | 91.50% | 8.10% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.40% | 20.30% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 4.20% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 22.20% | 2.22% | 0.00% | TAA: 1.11%; TAAA: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1011728450 | T -> TAAA | LOC_Os10g22600.1 | upstream_gene_variant ; 3141.0bp to feature; MODIFIER | silent_mutation | Average:61.95; most accessible tissue: Callus, score: 95.109 | N | N | N | N |
| vg1011728450 | T -> TAAA | LOC_Os10g22590.1 | downstream_gene_variant ; 2025.0bp to feature; MODIFIER | silent_mutation | Average:61.95; most accessible tissue: Callus, score: 95.109 | N | N | N | N |
| vg1011728450 | T -> TAAA | LOC_Os10g22590-LOC_Os10g22600 | intergenic_region ; MODIFIER | silent_mutation | Average:61.95; most accessible tissue: Callus, score: 95.109 | N | N | N | N |
| vg1011728450 | T -> TAA | LOC_Os10g22600.1 | upstream_gene_variant ; 3141.0bp to feature; MODIFIER | silent_mutation | Average:61.95; most accessible tissue: Callus, score: 95.109 | N | N | N | N |
| vg1011728450 | T -> TAA | LOC_Os10g22590.1 | downstream_gene_variant ; 2025.0bp to feature; MODIFIER | silent_mutation | Average:61.95; most accessible tissue: Callus, score: 95.109 | N | N | N | N |
| vg1011728450 | T -> TAA | LOC_Os10g22590-LOC_Os10g22600 | intergenic_region ; MODIFIER | silent_mutation | Average:61.95; most accessible tissue: Callus, score: 95.109 | N | N | N | N |
| vg1011728450 | T -> TA | LOC_Os10g22600.1 | upstream_gene_variant ; 3141.0bp to feature; MODIFIER | silent_mutation | Average:61.95; most accessible tissue: Callus, score: 95.109 | N | N | N | N |
| vg1011728450 | T -> TA | LOC_Os10g22590.1 | downstream_gene_variant ; 2025.0bp to feature; MODIFIER | silent_mutation | Average:61.95; most accessible tissue: Callus, score: 95.109 | N | N | N | N |
| vg1011728450 | T -> TA | LOC_Os10g22590-LOC_Os10g22600 | intergenic_region ; MODIFIER | silent_mutation | Average:61.95; most accessible tissue: Callus, score: 95.109 | N | N | N | N |
| vg1011728450 | T -> A | LOC_Os10g22600.1 | upstream_gene_variant ; 3142.0bp to feature; MODIFIER | silent_mutation | Average:61.95; most accessible tissue: Callus, score: 95.109 | N | N | N | N |
| vg1011728450 | T -> A | LOC_Os10g22590.1 | downstream_gene_variant ; 2024.0bp to feature; MODIFIER | silent_mutation | Average:61.95; most accessible tissue: Callus, score: 95.109 | N | N | N | N |
| vg1011728450 | T -> A | LOC_Os10g22590-LOC_Os10g22600 | intergenic_region ; MODIFIER | silent_mutation | Average:61.95; most accessible tissue: Callus, score: 95.109 | N | N | N | N |
| vg1011728450 | T -> TTA | LOC_Os10g22600.1 | upstream_gene_variant ; 3141.0bp to feature; MODIFIER | silent_mutation | Average:61.95; most accessible tissue: Callus, score: 95.109 | N | N | N | N |
| vg1011728450 | T -> TTA | LOC_Os10g22590.1 | downstream_gene_variant ; 2025.0bp to feature; MODIFIER | silent_mutation | Average:61.95; most accessible tissue: Callus, score: 95.109 | N | N | N | N |
| vg1011728450 | T -> TTA | LOC_Os10g22590-LOC_Os10g22600 | intergenic_region ; MODIFIER | silent_mutation | Average:61.95; most accessible tissue: Callus, score: 95.109 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1011728450 | NA | 4.95E-06 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011728450 | NA | 8.08E-08 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011728450 | 4.40E-06 | NA | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011728450 | NA | 1.63E-10 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011728450 | NA | 2.23E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011728450 | NA | 3.42E-06 | mr1550 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011728450 | NA | 1.98E-06 | mr1570 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011728450 | NA | 3.62E-08 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011728450 | 7.37E-06 | NA | mr1735 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011728450 | NA | 4.61E-06 | mr1775 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011728450 | 4.70E-06 | NA | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011728450 | NA | 2.63E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |