\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011720271:

Variant ID: vg1011720271 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11720271
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTTAAAACCACTTCGATATAGAAAGTTTTTTTTTAAAAAAATATACCATTTAGTAGGCGAGGAAAATAGCTCACTCCATTTATACAAATGAAAGTAGC[G/T]
TTAGGCTGCGTCTGGCAGTAGCACAAAGATTAAAACTCTCTTGTTTTTGTGCGCGCGCTTTTAGAAAAAGTTGCTTGACAAAATCAAATTAATTTTTTTT

Reverse complement sequence

AAAAAAAATTAATTTGATTTTGTCAAGCAACTTTTTCTAAAAGCGCGCGCACAAAAACAAGAGAGTTTTAATCTTTGTGCTACTGCCAGACGCAGCCTAA[C/A]
GCTACTTTCATTTGTATAAATGGAGTGAGCTATTTTCCTCGCCTACTAAATGGTATATTTTTTTAAAAAAAAACTTTCTATATCGAAGTGGTTTTAAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.80% 5.50% 0.17% 0.53% NA
All Indica  2759 99.90% 0.00% 0.14% 0.00% NA
All Japonica  1512 81.20% 17.10% 0.20% 1.52% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.00% 0.43% 0.00% NA
Indica III  913 99.80% 0.00% 0.22% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 80.80% 16.90% 0.13% 2.09% NA
Tropical Japonica  504 76.20% 22.60% 0.20% 0.99% NA
Japonica Intermediate  241 92.90% 5.80% 0.41% 0.83% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 93.30% 4.40% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011720271 G -> T LOC_Os10g22580.1 upstream_gene_variant ; 2404.0bp to feature; MODIFIER silent_mutation Average:56.537; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg1011720271 G -> T LOC_Os10g22590.1 upstream_gene_variant ; 3148.0bp to feature; MODIFIER silent_mutation Average:56.537; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg1011720271 G -> T LOC_Os10g22580-LOC_Os10g22590 intergenic_region ; MODIFIER silent_mutation Average:56.537; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg1011720271 G -> DEL N N silent_mutation Average:56.537; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011720271 3.04E-06 NA mr1771 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251