\
| Variant ID: vg1011645008 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 11645008 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, T: 0.01, others allele: 0.00, population size: 254. )
TTGTCTCACTATGATTCTGAATGTTTTCTTCTTCTTTTGTCTCATTGTGTTTCTGAATGTGTTCTCAATTTCTCACAGTGTGTTCTGAATGATCTCTCTG[T/A]
ACTCCGATCCACCCATTTTTCAGTGCTTGGTGGATTTATGATTTTTATGATCCTCGGAAAATAATGCACTATAATGTTAAATTATGGTATCGCTCAGTAT
ATACTGAGCGATACCATAATTTAACATTATAGTGCATTATTTTCCGAGGATCATAAAAATCATAAATCCACCAAGCACTGAAAAATGGGTGGATCGGAGT[A/T]
CAGAGAGATCATTCAGAACACACTGTGAGAAATTGAGAACACATTCAGAAACACAATGAGACAAAAGAAGAAGAAAACATTCAGAATCATAGTGAGACAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.90% | 11.00% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 66.90% | 33.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 39.40% | 60.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1011645008 | T -> A | LOC_Os10g22484.1 | downstream_gene_variant ; 4661.0bp to feature; MODIFIER | silent_mutation | Average:58.175; most accessible tissue: Callus, score: 89.466 | N | N | N | N |
| vg1011645008 | T -> A | LOC_Os10g22484.2 | downstream_gene_variant ; 4665.0bp to feature; MODIFIER | silent_mutation | Average:58.175; most accessible tissue: Callus, score: 89.466 | N | N | N | N |
| vg1011645008 | T -> A | LOC_Os10g22460-LOC_Os10g22484 | intergenic_region ; MODIFIER | silent_mutation | Average:58.175; most accessible tissue: Callus, score: 89.466 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1011645008 | NA | 2.32E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011645008 | NA | 2.37E-06 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011645008 | NA | 2.64E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011645008 | NA | 4.20E-06 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011645008 | NA | 7.66E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011645008 | NA | 8.28E-07 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011645008 | NA | 8.74E-12 | mr1902 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011645008 | NA | 3.24E-06 | mr1902 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011645008 | 3.21E-06 | NA | mr1932 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |