\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011645008:

Variant ID: vg1011645008 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11645008
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, T: 0.01, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTCTCACTATGATTCTGAATGTTTTCTTCTTCTTTTGTCTCATTGTGTTTCTGAATGTGTTCTCAATTTCTCACAGTGTGTTCTGAATGATCTCTCTG[T/A]
ACTCCGATCCACCCATTTTTCAGTGCTTGGTGGATTTATGATTTTTATGATCCTCGGAAAATAATGCACTATAATGTTAAATTATGGTATCGCTCAGTAT

Reverse complement sequence

ATACTGAGCGATACCATAATTTAACATTATAGTGCATTATTTTCCGAGGATCATAAAAATCATAAATCCACCAAGCACTGAAAAATGGGTGGATCGGAGT[A/T]
CAGAGAGATCATTCAGAACACACTGTGAGAAATTGAGAACACATTCAGAAACACAATGAGACAAAAGAAGAAGAAAACATTCAGAATCATAGTGAGACAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.90% 11.00% 0.02% 0.00% NA
All Indica  2759 99.60% 0.40% 0.04% 0.00% NA
All Japonica  1512 66.90% 33.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.30% 0.50% 0.17% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 39.40% 60.60% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 86.70% 13.30% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011645008 T -> A LOC_Os10g22484.1 downstream_gene_variant ; 4661.0bp to feature; MODIFIER silent_mutation Average:58.175; most accessible tissue: Callus, score: 89.466 N N N N
vg1011645008 T -> A LOC_Os10g22484.2 downstream_gene_variant ; 4665.0bp to feature; MODIFIER silent_mutation Average:58.175; most accessible tissue: Callus, score: 89.466 N N N N
vg1011645008 T -> A LOC_Os10g22460-LOC_Os10g22484 intergenic_region ; MODIFIER silent_mutation Average:58.175; most accessible tissue: Callus, score: 89.466 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011645008 NA 2.32E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011645008 NA 2.37E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011645008 NA 2.64E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011645008 NA 4.20E-06 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011645008 NA 7.66E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011645008 NA 8.28E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011645008 NA 8.74E-12 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011645008 NA 3.24E-06 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011645008 3.21E-06 NA mr1932 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251