Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011639148:

Variant ID: vg1011639148 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 11639148
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.06, T: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

ACAAAACTATAAATTTAACATGATATATTACAAATTTACATATTTAACGCTAAATTTGTCATAGAACTGTAGACTTAAGATAGAATATCGTAAAACTACA[G/A,T]
ATTTAATAACAAAATTATCACAAAACTATATGCTGAATATCAATTTAATCACAAAAATTGGACATTTATAACTCAAAAATAAAATTAATGCTACGGATTT

Reverse complement sequence

AAATCCGTAGCATTAATTTTATTTTTGAGTTATAAATGTCCAATTTTTGTGATTAAATTGATATTCAGCATATAGTTTTGTGATAATTTTGTTATTAAAT[C/T,A]
TGTAGTTTTACGATATTCTATCTTAAGTCTACAGTTCTATGACAAATTTAGCGTTAAATATGTAAATTTGTAATATATCATGTTAAATTTATAGTTTTGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.70%	37.10%	0.19%	0.00%	T: 0.02%
All Indica	2759	81.50%	18.20%	0.25%	0.00%	NA
All Japonica	1512	43.50%	56.40%	0.07%	0.00%	T: 0.07%
Aus	269	0.40%	99.60%	0.00%	0.00%	NA
Indica I	595	58.30%	41.20%	0.50%	0.00%	NA
Indica II	465	94.80%	5.20%	0.00%	0.00%	NA
Indica III	913	89.00%	10.80%	0.11%	0.00%	NA
Indica Intermediate	786	82.40%	17.20%	0.38%	0.00%	NA
Temperate Japonica	767	75.70%	24.10%	0.00%	0.00%	T: 0.13%
Tropical Japonica	504	5.40%	94.40%	0.20%	0.00%	NA
Japonica Intermediate	241	20.30%	79.70%	0.00%	0.00%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	50.00%	48.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1011639148	G -> T	LOC_Os10g22460.1	upstream_gene_variant ; 4659.0bp to feature; MODIFIER	silent_mutation	Average:29.509; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg1011639148	G -> T	LOC_Os10g22460-LOC_Os10g22484	intergenic_region ; MODIFIER	silent_mutation	Average:29.509; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg1011639148	G -> A	LOC_Os10g22460.1	upstream_gene_variant ; 4659.0bp to feature; MODIFIER	silent_mutation	Average:29.509; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg1011639148	G -> A	LOC_Os10g22460-LOC_Os10g22484	intergenic_region ; MODIFIER	silent_mutation	Average:29.509; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1011639148	NA	1.70E-06	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011639148	NA	1.64E-09	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011639148	NA	3.25E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011639148	NA	6.98E-09	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011639148	NA	1.68E-06	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011639148	1.59E-07	NA	mr1486_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011639148	NA	4.52E-07	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011639148	NA	8.12E-10	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011639148	NA	5.73E-15	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251