\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011639148:

Variant ID: vg1011639148 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11639148
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.06, T: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAAACTATAAATTTAACATGATATATTACAAATTTACATATTTAACGCTAAATTTGTCATAGAACTGTAGACTTAAGATAGAATATCGTAAAACTACA[G/A,T]
ATTTAATAACAAAATTATCACAAAACTATATGCTGAATATCAATTTAATCACAAAAATTGGACATTTATAACTCAAAAATAAAATTAATGCTACGGATTT

Reverse complement sequence

AAATCCGTAGCATTAATTTTATTTTTGAGTTATAAATGTCCAATTTTTGTGATTAAATTGATATTCAGCATATAGTTTTGTGATAATTTTGTTATTAAAT[C/T,A]
TGTAGTTTTACGATATTCTATCTTAAGTCTACAGTTCTATGACAAATTTAGCGTTAAATATGTAAATTTGTAATATATCATGTTAAATTTATAGTTTTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.70% 37.10% 0.19% 0.00% T: 0.02%
All Indica  2759 81.50% 18.20% 0.25% 0.00% NA
All Japonica  1512 43.50% 56.40% 0.07% 0.00% T: 0.07%
Aus  269 0.40% 99.60% 0.00% 0.00% NA
Indica I  595 58.30% 41.20% 0.50% 0.00% NA
Indica II  465 94.80% 5.20% 0.00% 0.00% NA
Indica III  913 89.00% 10.80% 0.11% 0.00% NA
Indica Intermediate  786 82.40% 17.20% 0.38% 0.00% NA
Temperate Japonica  767 75.70% 24.10% 0.00% 0.00% T: 0.13%
Tropical Japonica  504 5.40% 94.40% 0.20% 0.00% NA
Japonica Intermediate  241 20.30% 79.70% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 50.00% 48.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011639148 G -> T LOC_Os10g22460.1 upstream_gene_variant ; 4659.0bp to feature; MODIFIER silent_mutation Average:29.509; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg1011639148 G -> T LOC_Os10g22460-LOC_Os10g22484 intergenic_region ; MODIFIER silent_mutation Average:29.509; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg1011639148 G -> A LOC_Os10g22460.1 upstream_gene_variant ; 4659.0bp to feature; MODIFIER silent_mutation Average:29.509; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg1011639148 G -> A LOC_Os10g22460-LOC_Os10g22484 intergenic_region ; MODIFIER silent_mutation Average:29.509; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011639148 NA 1.70E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011639148 NA 1.64E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011639148 NA 3.25E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011639148 NA 6.98E-09 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011639148 NA 1.68E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011639148 1.59E-07 NA mr1486_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011639148 NA 4.52E-07 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011639148 NA 8.12E-10 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011639148 NA 5.73E-15 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251