Variant ID: vg1011639148 (JBrowse) | Variation Type: SNP |
Chromosome: chr10 | Position: 11639148 |
Reference Allele: G | Alternative Allele: A,T |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.06, T: 0.03, others allele: 0.00, population size: 109. )
ACAAAACTATAAATTTAACATGATATATTACAAATTTACATATTTAACGCTAAATTTGTCATAGAACTGTAGACTTAAGATAGAATATCGTAAAACTACA[G/A,T]
ATTTAATAACAAAATTATCACAAAACTATATGCTGAATATCAATTTAATCACAAAAATTGGACATTTATAACTCAAAAATAAAATTAATGCTACGGATTT
AAATCCGTAGCATTAATTTTATTTTTGAGTTATAAATGTCCAATTTTTGTGATTAAATTGATATTCAGCATATAGTTTTGTGATAATTTTGTTATTAAAT[C/T,A]
TGTAGTTTTACGATATTCTATCTTAAGTCTACAGTTCTATGACAAATTTAGCGTTAAATATGTAAATTTGTAATATATCATGTTAAATTTATAGTTTTGT
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 62.70% | 37.10% | 0.19% | 0.00% | T: 0.02% |
All Indica | 2759 | 81.50% | 18.20% | 0.25% | 0.00% | NA |
All Japonica | 1512 | 43.50% | 56.40% | 0.07% | 0.00% | T: 0.07% |
Aus | 269 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
Indica I | 595 | 58.30% | 41.20% | 0.50% | 0.00% | NA |
Indica II | 465 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 89.00% | 10.80% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 82.40% | 17.20% | 0.38% | 0.00% | NA |
Temperate Japonica | 767 | 75.70% | 24.10% | 0.00% | 0.00% | T: 0.13% |
Tropical Japonica | 504 | 5.40% | 94.40% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 20.30% | 79.70% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
Intermediate | 90 | 50.00% | 48.90% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1011639148 | G -> T | LOC_Os10g22460.1 | upstream_gene_variant ; 4659.0bp to feature; MODIFIER | silent_mutation | Average:29.509; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
vg1011639148 | G -> T | LOC_Os10g22460-LOC_Os10g22484 | intergenic_region ; MODIFIER | silent_mutation | Average:29.509; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
vg1011639148 | G -> A | LOC_Os10g22460.1 | upstream_gene_variant ; 4659.0bp to feature; MODIFIER | silent_mutation | Average:29.509; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
vg1011639148 | G -> A | LOC_Os10g22460-LOC_Os10g22484 | intergenic_region ; MODIFIER | silent_mutation | Average:29.509; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1011639148 | NA | 1.70E-06 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1011639148 | NA | 1.64E-09 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1011639148 | NA | 3.25E-07 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1011639148 | NA | 6.98E-09 | mr1942 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1011639148 | NA | 1.68E-06 | mr1295_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1011639148 | 1.59E-07 | NA | mr1486_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1011639148 | NA | 4.52E-07 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1011639148 | NA | 8.12E-10 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1011639148 | NA | 5.73E-15 | mr1794_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |