Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011535971:

Variant ID: vg1011535971 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 11535971
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTTACGGCTAAAATATAATGAATTTGACGTTAAGATTTTAACCCTAGGTATAATACAATTGAAAGTATGTGTATGTTTTTTTCTAGATTTTTTGGTGA[C/T]
ATTTTTTAGTTGGTGTGCACGTGTGTACACGTGAGGGCCTGTGTGCATAGGATATGTTGCCTATTTAGAGATTGTTTAGAACACGGGATATTTTAAGCAA

Reverse complement sequence

TTGCTTAAAATATCCCGTGTTCTAAACAATCTCTAAATAGGCAACATATCCTATGCACACAGGCCCTCACGTGTACACACGTGCACACCAACTAAAAAAT[G/A]
TCACCAAAAAATCTAGAAAAAAACATACACATACTTTCAATTGTATTATACCTAGGGTTAAAATCTTAACGTCAAATTCATTATATTTTAGCCGTAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.90%	0.60%	20.69%	39.74%	NA
All Indica	2759	35.60%	0.30%	19.35%	44.76%	NA
All Japonica	1512	44.40%	1.30%	21.16%	33.13%	NA
Aus	269	41.30%	0.40%	29.00%	29.37%	NA
Indica I	595	34.30%	0.20%	25.38%	40.17%	NA
Indica II	465	24.90%	0.00%	18.06%	56.99%	NA
Indica III	913	45.80%	0.30%	14.13%	39.76%	NA
Indica Intermediate	786	31.00%	0.50%	21.63%	46.82%	NA
Temperate Japonica	767	75.20%	0.40%	6.39%	17.99%	NA
Tropical Japonica	504	10.70%	3.20%	40.67%	45.44%	NA
Japonica Intermediate	241	16.60%	0.40%	27.39%	55.60%	NA
VI/Aromatic	96	40.60%	0.00%	29.17%	30.21%	NA
Intermediate	90	41.10%	1.10%	20.00%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1011535971	C -> T	LOC_Os10g22310.1	upstream_gene_variant ; 1666.0bp to feature; MODIFIER	silent_mutation	Average:9.559; most accessible tissue: Callus, score: 46.578	N	N	N	N
vg1011535971	C -> T	LOC_Os10g22310.2	upstream_gene_variant ; 1666.0bp to feature; MODIFIER	silent_mutation	Average:9.559; most accessible tissue: Callus, score: 46.578	N	N	N	N
vg1011535971	C -> T	LOC_Os10g22310.3	upstream_gene_variant ; 1666.0bp to feature; MODIFIER	silent_mutation	Average:9.559; most accessible tissue: Callus, score: 46.578	N	N	N	N
vg1011535971	C -> T	LOC_Os10g22310.4	upstream_gene_variant ; 4045.0bp to feature; MODIFIER	silent_mutation	Average:9.559; most accessible tissue: Callus, score: 46.578	N	N	N	N
vg1011535971	C -> T	LOC_Os10g22300.1	downstream_gene_variant ; 580.0bp to feature; MODIFIER	silent_mutation	Average:9.559; most accessible tissue: Callus, score: 46.578	N	N	N	N
vg1011535971	C -> T	LOC_Os10g22300-LOC_Os10g22310	intergenic_region ; MODIFIER	silent_mutation	Average:9.559; most accessible tissue: Callus, score: 46.578	N	N	N	N
vg1011535971	C -> DEL	N	N	silent_mutation	Average:9.559; most accessible tissue: Callus, score: 46.578	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1011535971	9.48E-06	NA	mr1277	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251