\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011517194:

Variant ID: vg1011517194 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11517194
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCAAATACAAGTTCTTATGGTGTTCCTTAGCAAAGACCACATTTTTCGAGTGTCCTAGAGCAAATTTTGCCTAATAATAATGGAGTATGATTTTTATCA[A/T]
TTCAATTTGCTTACTTGATTTATCATTGCCTTGTTTGATTTTTTGGCTTAGTTAATGAGGACTGAGAGTTTTTTGACAACTTTTGCAAGTTTTAGGCTCA

Reverse complement sequence

TGAGCCTAAAACTTGCAAAAGTTGTCAAAAAACTCTCAGTCCTCATTAACTAAGCCAAAAAATCAAACAAGGCAATGATAAATCAAGTAAGCAAATTGAA[T/A]
TGATAAAAATCATACTCCATTATTATTAGGCAAAATTTGCTCTAGGACACTCGAAAAATGTGGTCTTTGCTAAGGAACACCATAAGAACTTGTATTTGCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.80% 0.20% 14.71% 21.31% NA
All Indica  2759 61.80% 0.30% 18.01% 19.90% NA
All Japonica  1512 64.90% 0.00% 9.59% 25.46% NA
Aus  269 68.80% 0.40% 13.01% 17.84% NA
Indica I  595 71.60% 0.20% 14.12% 14.12% NA
Indica II  465 65.60% 0.20% 14.19% 20.00% NA
Indica III  913 54.80% 0.00% 22.45% 22.78% NA
Indica Intermediate  786 60.30% 0.80% 18.07% 20.87% NA
Temperate Japonica  767 88.90% 0.00% 0.78% 10.30% NA
Tropical Japonica  504 39.70% 0.00% 23.81% 36.51% NA
Japonica Intermediate  241 41.50% 0.00% 7.88% 50.62% NA
VI/Aromatic  96 87.50% 0.00% 5.21% 7.29% NA
Intermediate  90 64.40% 1.10% 14.44% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011517194 A -> T LOC_Os10g22240.1 downstream_gene_variant ; 4340.0bp to feature; MODIFIER silent_mutation Average:15.274; most accessible tissue: Callus, score: 51.175 N N N N
vg1011517194 A -> T LOC_Os10g22250.1 downstream_gene_variant ; 1322.0bp to feature; MODIFIER silent_mutation Average:15.274; most accessible tissue: Callus, score: 51.175 N N N N
vg1011517194 A -> T LOC_Os10g22260.1 downstream_gene_variant ; 221.0bp to feature; MODIFIER silent_mutation Average:15.274; most accessible tissue: Callus, score: 51.175 N N N N
vg1011517194 A -> T LOC_Os10g22250-LOC_Os10g22260 intergenic_region ; MODIFIER silent_mutation Average:15.274; most accessible tissue: Callus, score: 51.175 N N N N
vg1011517194 A -> DEL N N silent_mutation Average:15.274; most accessible tissue: Callus, score: 51.175 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011517194 5.87E-06 NA mr1844 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011517194 9.54E-06 3.12E-06 mr1361_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011517194 7.13E-06 7.16E-06 mr1487_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011517194 7.60E-07 7.60E-07 mr1487_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251