\
| Variant ID: vg1011517194 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 11517194 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGCAAATACAAGTTCTTATGGTGTTCCTTAGCAAAGACCACATTTTTCGAGTGTCCTAGAGCAAATTTTGCCTAATAATAATGGAGTATGATTTTTATCA[A/T]
TTCAATTTGCTTACTTGATTTATCATTGCCTTGTTTGATTTTTTGGCTTAGTTAATGAGGACTGAGAGTTTTTTGACAACTTTTGCAAGTTTTAGGCTCA
TGAGCCTAAAACTTGCAAAAGTTGTCAAAAAACTCTCAGTCCTCATTAACTAAGCCAAAAAATCAAACAAGGCAATGATAAATCAAGTAAGCAAATTGAA[T/A]
TGATAAAAATCATACTCCATTATTATTAGGCAAAATTTGCTCTAGGACACTCGAAAAATGTGGTCTTTGCTAAGGAACACCATAAGAACTTGTATTTGCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.80% | 0.20% | 14.71% | 21.31% | NA |
| All Indica | 2759 | 61.80% | 0.30% | 18.01% | 19.90% | NA |
| All Japonica | 1512 | 64.90% | 0.00% | 9.59% | 25.46% | NA |
| Aus | 269 | 68.80% | 0.40% | 13.01% | 17.84% | NA |
| Indica I | 595 | 71.60% | 0.20% | 14.12% | 14.12% | NA |
| Indica II | 465 | 65.60% | 0.20% | 14.19% | 20.00% | NA |
| Indica III | 913 | 54.80% | 0.00% | 22.45% | 22.78% | NA |
| Indica Intermediate | 786 | 60.30% | 0.80% | 18.07% | 20.87% | NA |
| Temperate Japonica | 767 | 88.90% | 0.00% | 0.78% | 10.30% | NA |
| Tropical Japonica | 504 | 39.70% | 0.00% | 23.81% | 36.51% | NA |
| Japonica Intermediate | 241 | 41.50% | 0.00% | 7.88% | 50.62% | NA |
| VI/Aromatic | 96 | 87.50% | 0.00% | 5.21% | 7.29% | NA |
| Intermediate | 90 | 64.40% | 1.10% | 14.44% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1011517194 | A -> T | LOC_Os10g22240.1 | downstream_gene_variant ; 4340.0bp to feature; MODIFIER | silent_mutation | Average:15.274; most accessible tissue: Callus, score: 51.175 | N | N | N | N |
| vg1011517194 | A -> T | LOC_Os10g22250.1 | downstream_gene_variant ; 1322.0bp to feature; MODIFIER | silent_mutation | Average:15.274; most accessible tissue: Callus, score: 51.175 | N | N | N | N |
| vg1011517194 | A -> T | LOC_Os10g22260.1 | downstream_gene_variant ; 221.0bp to feature; MODIFIER | silent_mutation | Average:15.274; most accessible tissue: Callus, score: 51.175 | N | N | N | N |
| vg1011517194 | A -> T | LOC_Os10g22250-LOC_Os10g22260 | intergenic_region ; MODIFIER | silent_mutation | Average:15.274; most accessible tissue: Callus, score: 51.175 | N | N | N | N |
| vg1011517194 | A -> DEL | N | N | silent_mutation | Average:15.274; most accessible tissue: Callus, score: 51.175 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1011517194 | 5.87E-06 | NA | mr1844 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011517194 | 9.54E-06 | 3.12E-06 | mr1361_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011517194 | 7.13E-06 | 7.16E-06 | mr1487_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011517194 | 7.60E-07 | 7.60E-07 | mr1487_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |