\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011512136:

Variant ID: vg1011512136 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11512136
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTCAAGACTCTCGCAAGGAACTCAACCATATTTTCGGTGGACCCGAAGCTTACGAGTCCAAGCGGAAGCAAAAGTTGACTGAAAGGGAGATTAACGCC[G/A,T]
TCCAGCCCGATACACCCCAATATCTTCGGTGGTTAGAGACAGCAATCAAGTTTGACCGCTCGGATCATCCTGACCGAGTGGTCCAGCCGGGATGGTACCC

Reverse complement sequence

GGGTACCATCCCGGCTGGACCACTCGGTCAGGATGATCCGAGCGGTCAAACTTGATTGCTGTCTCTAACCACCGAAGATATTGGGGTGTATCGGGCTGGA[C/T,A]
GGCGTTAATCTCCCTTTCAGTCAACTTTTGCTTCCGCTTGGACTCGTAAGCTTCGGGTCCACCGAAAATATGGTTGAGTTCCTTGCGAGAGTCTTGAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.30% 37.60% 5.14% 14.92% T: 0.02%
All Indica  2759 36.30% 45.10% 5.80% 12.76% T: 0.04%
All Japonica  1512 54.30% 29.70% 2.45% 13.56% NA
Aus  269 18.20% 20.40% 12.27% 49.07% NA
Indica I  595 47.90% 42.50% 3.03% 6.55% NA
Indica II  465 37.20% 53.50% 3.01% 6.24% NA
Indica III  913 31.20% 38.90% 8.98% 20.81% T: 0.11%
Indica Intermediate  786 32.80% 49.40% 5.85% 11.96% NA
Temperate Japonica  767 86.70% 2.50% 2.48% 8.34% NA
Tropical Japonica  504 13.90% 74.60% 1.39% 10.12% NA
Japonica Intermediate  241 35.70% 22.40% 4.56% 37.34% NA
VI/Aromatic  96 84.40% 8.30% 6.25% 1.04% NA
Intermediate  90 51.10% 24.40% 7.78% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011512136 G -> T LOC_Os10g22240.1 missense_variant ; p.Val578Phe; MODERATE nonsynonymous_codon ; V578F Average:25.124; most accessible tissue: Minghui63 panicle, score: 42.799 probably damaging 2.285 DELETERIOUS 0.00
vg1011512136 G -> A LOC_Os10g22240.1 missense_variant ; p.Val578Ile; MODERATE nonsynonymous_codon ; V578I Average:25.124; most accessible tissue: Minghui63 panicle, score: 42.799 benign 0.416 DELETERIOUS 0.02
vg1011512136 G -> DEL LOC_Os10g22240.1 N frameshift_variant Average:25.124; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011512136 4.31E-06 4.04E-16 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 1.74E-06 1.75E-16 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 NA 1.61E-14 mr1018 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 NA 1.47E-12 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 3.52E-07 1.00E-17 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 NA 3.65E-14 mr1079 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 8.79E-07 1.73E-17 mr1132 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 NA 2.38E-14 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 3.46E-06 3.81E-15 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 NA 7.11E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 NA 7.05E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 NA 2.07E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 3.08E-07 1.34E-16 mr1390 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 4.82E-08 2.59E-17 mr1490 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 NA 9.11E-15 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 NA 2.65E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 NA 1.37E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 NA 2.15E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 NA 1.41E-12 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 NA 7.29E-09 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 NA 1.22E-15 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 NA 2.55E-14 mr1079_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 3.62E-06 2.74E-20 mr1132_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 3.24E-07 1.35E-22 mr1178_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 NA 5.91E-10 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 1.39E-07 4.78E-20 mr1390_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 1.58E-07 2.26E-20 mr1490_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 NA 4.19E-14 mr1539_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 NA 9.93E-14 mr1732_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136 NA 1.34E-09 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251