Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011512136:

Variant ID: vg1011512136 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 11512136
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTCAAGACTCTCGCAAGGAACTCAACCATATTTTCGGTGGACCCGAAGCTTACGAGTCCAAGCGGAAGCAAAAGTTGACTGAAAGGGAGATTAACGCC[G/A,T]
TCCAGCCCGATACACCCCAATATCTTCGGTGGTTAGAGACAGCAATCAAGTTTGACCGCTCGGATCATCCTGACCGAGTGGTCCAGCCGGGATGGTACCC

Reverse complement sequence

GGGTACCATCCCGGCTGGACCACTCGGTCAGGATGATCCGAGCGGTCAAACTTGATTGCTGTCTCTAACCACCGAAGATATTGGGGTGTATCGGGCTGGA[C/T,A]
GGCGTTAATCTCCCTTTCAGTCAACTTTTGCTTCCGCTTGGACTCGTAAGCTTCGGGTCCACCGAAAATATGGTTGAGTTCCTTGCGAGAGTCTTGAAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.30%	37.60%	5.14%	14.92%	T: 0.02%
All Indica	2759	36.30%	45.10%	5.80%	12.76%	T: 0.04%
All Japonica	1512	54.30%	29.70%	2.45%	13.56%	NA
Aus	269	18.20%	20.40%	12.27%	49.07%	NA
Indica I	595	47.90%	42.50%	3.03%	6.55%	NA
Indica II	465	37.20%	53.50%	3.01%	6.24%	NA
Indica III	913	31.20%	38.90%	8.98%	20.81%	T: 0.11%
Indica Intermediate	786	32.80%	49.40%	5.85%	11.96%	NA
Temperate Japonica	767	86.70%	2.50%	2.48%	8.34%	NA
Tropical Japonica	504	13.90%	74.60%	1.39%	10.12%	NA
Japonica Intermediate	241	35.70%	22.40%	4.56%	37.34%	NA
VI/Aromatic	96	84.40%	8.30%	6.25%	1.04%	NA
Intermediate	90	51.10%	24.40%	7.78%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1011512136	G -> T	LOC_Os10g22240.1	missense_variant ; p.Val578Phe; MODERATE	nonsynonymous_codon ; V578F	Average:25.124; most accessible tissue: Minghui63 panicle, score: 42.799	probably damaging	2.285	DELETERIOUS	0.00
vg1011512136	G -> A	LOC_Os10g22240.1	missense_variant ; p.Val578Ile; MODERATE	nonsynonymous_codon ; V578I	Average:25.124; most accessible tissue: Minghui63 panicle, score: 42.799	benign	0.416	DELETERIOUS	0.02
vg1011512136	G -> DEL	LOC_Os10g22240.1	N	frameshift_variant	Average:25.124; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1011512136	4.31E-06	4.04E-16	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	1.74E-06	1.75E-16	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	NA	1.61E-14	mr1018	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	NA	1.47E-12	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	3.52E-07	1.00E-17	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	NA	3.65E-14	mr1079	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	8.79E-07	1.73E-17	mr1132	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	NA	2.38E-14	mr1142	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	3.46E-06	3.81E-15	mr1178	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	NA	7.11E-07	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	NA	7.05E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	NA	2.07E-06	mr1382	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	3.08E-07	1.34E-16	mr1390	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	4.82E-08	2.59E-17	mr1490	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	NA	9.11E-15	mr1491	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	NA	2.65E-06	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	NA	1.37E-08	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	NA	2.15E-07	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	NA	1.41E-12	mr1019_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	NA	7.29E-09	mr1022_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	NA	1.22E-15	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	NA	2.55E-14	mr1079_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	3.62E-06	2.74E-20	mr1132_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	3.24E-07	1.35E-22	mr1178_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	NA	5.91E-10	mr1261_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	1.39E-07	4.78E-20	mr1390_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	1.58E-07	2.26E-20	mr1490_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	NA	4.19E-14	mr1539_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	NA	9.93E-14	mr1732_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512136	NA	1.34E-09	mr1771_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251