\
| Variant ID: vg1011512074 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 11512074 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCGACTGATGGAGAACAAAGCACTTCAAAAAAGAAGGATGATGACTATGACGGATCGACTGGTTTTCAAGACTCTCGCAAGGAACTCAACCATATTTTCG[G/A]
TGGACCCGAAGCTTACGAGTCCAAGCGGAAGCAAAAGTTGACTGAAAGGGAGATTAACGCCGTCCAGCCCGATACACCCCAATATCTTCGGTGGTTAGAG
CTCTAACCACCGAAGATATTGGGGTGTATCGGGCTGGACGGCGTTAATCTCCCTTTCAGTCAACTTTTGCTTCCGCTTGGACTCGTAAGCTTCGGGTCCA[C/T]
CGAAAATATGGTTGAGTTCCTTGCGAGAGTCTTGAAAACCAGTCGATCCGTCATAGTCATCATCCTTCTTTTTTGAAGTGCTTTGTTCTCCATCAGTCGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.60% | 39.00% | 2.71% | 18.62% | NA |
| All Indica | 2759 | 32.70% | 47.20% | 3.30% | 16.82% | NA |
| All Japonica | 1512 | 53.40% | 30.00% | 1.72% | 14.95% | NA |
| Aus | 269 | 14.90% | 21.20% | 2.23% | 61.71% | NA |
| Indica I | 595 | 48.20% | 41.70% | 2.18% | 7.90% | NA |
| Indica II | 465 | 27.70% | 61.90% | 2.58% | 7.74% | NA |
| Indica III | 913 | 26.80% | 40.00% | 4.38% | 28.81% | NA |
| Indica Intermediate | 786 | 30.50% | 51.10% | 3.31% | 15.01% | NA |
| Temperate Japonica | 767 | 85.90% | 2.70% | 2.61% | 8.74% | NA |
| Tropical Japonica | 504 | 13.50% | 74.80% | 0.20% | 11.51% | NA |
| Japonica Intermediate | 241 | 33.20% | 22.80% | 2.07% | 41.91% | NA |
| VI/Aromatic | 96 | 83.30% | 9.40% | 1.04% | 6.25% | NA |
| Intermediate | 90 | 50.00% | 25.60% | 4.44% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1011512074 | G -> A | LOC_Os10g22240.1 | missense_variant ; p.Gly557Asp; MODERATE | nonsynonymous_codon ; G557D | Average:27.743; most accessible tissue: Callus, score: 42.027 | unknown | unknown | DELETERIOUS | 0.01 |
| vg1011512074 | G -> DEL | LOC_Os10g22240.1 | N | frameshift_variant | Average:27.743; most accessible tissue: Callus, score: 42.027 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1011512074 | NA | 1.08E-13 | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512074 | NA | 2.00E-14 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512074 | NA | 2.29E-10 | mr1018 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512074 | NA | 5.29E-10 | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512074 | NA | 2.49E-14 | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512074 | NA | 1.95E-13 | mr1132 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512074 | NA | 4.15E-13 | mr1178 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512074 | NA | 6.47E-06 | mr1382 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512074 | NA | 5.58E-13 | mr1390 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512074 | NA | 2.84E-13 | mr1490 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512074 | NA | 7.79E-11 | mr1551 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512074 | NA | 3.31E-07 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512074 | NA | 5.45E-10 | mr1019_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512074 | NA | 1.32E-12 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512074 | NA | 3.16E-15 | mr1132_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512074 | NA | 2.39E-18 | mr1178_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512074 | NA | 6.30E-15 | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011512074 | NA | 6.24E-16 | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |