\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011512074:

Variant ID: vg1011512074 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11512074
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGACTGATGGAGAACAAAGCACTTCAAAAAAGAAGGATGATGACTATGACGGATCGACTGGTTTTCAAGACTCTCGCAAGGAACTCAACCATATTTTCG[G/A]
TGGACCCGAAGCTTACGAGTCCAAGCGGAAGCAAAAGTTGACTGAAAGGGAGATTAACGCCGTCCAGCCCGATACACCCCAATATCTTCGGTGGTTAGAG

Reverse complement sequence

CTCTAACCACCGAAGATATTGGGGTGTATCGGGCTGGACGGCGTTAATCTCCCTTTCAGTCAACTTTTGCTTCCGCTTGGACTCGTAAGCTTCGGGTCCA[C/T]
CGAAAATATGGTTGAGTTCCTTGCGAGAGTCTTGAAAACCAGTCGATCCGTCATAGTCATCATCCTTCTTTTTTGAAGTGCTTTGTTCTCCATCAGTCGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.60% 39.00% 2.71% 18.62% NA
All Indica  2759 32.70% 47.20% 3.30% 16.82% NA
All Japonica  1512 53.40% 30.00% 1.72% 14.95% NA
Aus  269 14.90% 21.20% 2.23% 61.71% NA
Indica I  595 48.20% 41.70% 2.18% 7.90% NA
Indica II  465 27.70% 61.90% 2.58% 7.74% NA
Indica III  913 26.80% 40.00% 4.38% 28.81% NA
Indica Intermediate  786 30.50% 51.10% 3.31% 15.01% NA
Temperate Japonica  767 85.90% 2.70% 2.61% 8.74% NA
Tropical Japonica  504 13.50% 74.80% 0.20% 11.51% NA
Japonica Intermediate  241 33.20% 22.80% 2.07% 41.91% NA
VI/Aromatic  96 83.30% 9.40% 1.04% 6.25% NA
Intermediate  90 50.00% 25.60% 4.44% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011512074 G -> A LOC_Os10g22240.1 missense_variant ; p.Gly557Asp; MODERATE nonsynonymous_codon ; G557D Average:27.743; most accessible tissue: Callus, score: 42.027 unknown unknown DELETERIOUS 0.01
vg1011512074 G -> DEL LOC_Os10g22240.1 N frameshift_variant Average:27.743; most accessible tissue: Callus, score: 42.027 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011512074 NA 1.08E-13 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512074 NA 2.00E-14 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512074 NA 2.29E-10 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512074 NA 5.29E-10 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512074 NA 2.49E-14 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512074 NA 1.95E-13 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512074 NA 4.15E-13 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512074 NA 6.47E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512074 NA 5.58E-13 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512074 NA 2.84E-13 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512074 NA 7.79E-11 mr1551 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512074 NA 3.31E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512074 NA 5.45E-10 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512074 NA 1.32E-12 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512074 NA 3.16E-15 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512074 NA 2.39E-18 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512074 NA 6.30E-15 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011512074 NA 6.24E-16 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251