\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011511779:

Variant ID: vg1011511779 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11511779
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


CGCCAAAGCCGATGATGCTGTCACCGCATCCAAGCAGTCGGGCAGTAATTGGAAGCCCAAGAAAGATGCACCAGCGACAGGGGGGAGTGGAAGTACCAAC[C/T]
ATAAGGACCGCACGCGTAAGCCCGAGGACCTTGTGGCAACTACATCACCTTCTTCTCGATAGCGATCGCGCATCAATACCTTCGACAAGATCATGAATTC

Reverse complement sequence

GAATTCATGATCTTGTCGAAGGTATTGATGCGCGATCGCTATCGAGAAGAAGGTGATGTAGTTGCCACAAGGTCCTCGGGCTTACGCGTGCGGTCCTTAT[G/A]
GTTGGTACTTCCACTCCCCCCTGTCGCTGGTGCATCTTTCTTGGGCTTCCAATTACTGCCCGACTGCTTGGATGCGGTGACAGCATCATCGGCTTTGGCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.50% 38.30% 2.79% 11.43% NA
All Indica  2759 60.50% 31.90% 1.63% 5.98% NA
All Japonica  1512 30.60% 54.40% 1.65% 13.36% NA
Aus  269 24.20% 16.00% 1.86% 57.99% NA
Indica I  595 49.20% 46.70% 0.84% 3.19% NA
Indica II  465 58.90% 35.50% 1.94% 3.66% NA
Indica III  913 67.00% 21.70% 1.97% 9.31% NA
Indica Intermediate  786 62.20% 30.50% 1.65% 5.60% NA
Temperate Japonica  767 3.10% 87.90% 1.30% 7.69% NA
Tropical Japonica  504 76.00% 13.50% 0.99% 9.52% NA
Japonica Intermediate  241 23.20% 33.20% 4.15% 39.42% NA
VI/Aromatic  96 17.70% 21.90% 55.21% 5.21% NA
Intermediate  90 34.40% 47.80% 4.44% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011511779 C -> T LOC_Os10g22240.1 missense_variant ; p.His501Tyr; MODERATE nonsynonymous_codon ; H501Y Average:28.465; most accessible tissue: Callus, score: 39.024 benign -0.153 DELETERIOUS 0.01
vg1011511779 C -> DEL LOC_Os10g22240.1 N frameshift_variant Average:28.465; most accessible tissue: Callus, score: 39.024 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011511779 2.03E-06 1.92E-16 mr1016 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511779 2.07E-06 1.55E-16 mr1017 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511779 NA 4.47E-13 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511779 NA 2.67E-12 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511779 1.75E-07 2.35E-18 mr1055 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511779 NA 2.02E-13 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511779 2.64E-06 9.73E-17 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511779 9.08E-07 3.47E-16 mr1178 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511779 NA 5.78E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511779 NA 5.12E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511779 4.68E-07 1.49E-16 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511779 1.01E-07 3.89E-17 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511779 NA 3.05E-09 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511779 NA 1.15E-06 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511779 NA 1.33E-11 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511779 7.91E-06 2.06E-15 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511779 NA 1.66E-13 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511779 6.31E-06 6.88E-19 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511779 1.62E-07 1.78E-22 mr1178_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511779 NA 1.10E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511779 6.86E-07 1.21E-18 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511779 2.75E-07 2.05E-19 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511779 NA 2.51E-10 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251