Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011449672:

Variant ID: vg1011449672 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 11449672
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.01, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:

TTACCTAAACACCATGTCTAAGTAATTAATATCTACTTTAGTGTTTATAACTCACCAAAGCAATCACTATATTTTAGTTGATTATAGTGAACAATAATCC[T/C]
GTATGCTATTTAGGAACTAACCAAGAGATAATTCTTACAAGATAAATCTAAATTACTCAAGAAGATAATTCTATTGAAATCAGTAATAAACAGAATAAAA

Reverse complement sequence

TTTTATTCTGTTTATTACTGATTTCAATAGAATTATCTTCTTGAGTAATTTAGATTTATCTTGTAAGAATTATCTCTTGGTTAGTTCCTAAATAGCATAC[A/G]
GGATTATTGTTCACTATAATCAACTAAAATATAGTGATTGCTTTGGTGAGTTATAAACACTAAAGTAGATATTAATTACTTAGACATGGTGTTTAGGTAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.80%	1.20%	7.98%	37.03%	NA
All Indica	2759	64.30%	0.10%	10.80%	24.86%	NA
All Japonica	1512	39.60%	3.50%	2.45%	54.43%	NA
Aus	269	34.60%	0.40%	8.92%	56.13%	NA
Indica I	595	69.70%	0.20%	12.94%	17.14%	NA
Indica II	465	60.40%	0.00%	11.18%	28.39%	NA
Indica III	913	65.60%	0.10%	8.21%	26.07%	NA
Indica Intermediate	786	60.80%	0.00%	11.96%	27.23%	NA
Temperate Japonica	767	69.10%	6.60%	1.30%	22.95%	NA
Tropical Japonica	504	7.90%	0.40%	2.98%	88.69%	NA
Japonica Intermediate	241	12.00%	0.00%	4.98%	82.99%	NA
VI/Aromatic	96	29.20%	0.00%	9.38%	61.46%	NA
Intermediate	90	53.30%	2.20%	10.00%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1011449672	T -> C	LOC_Os10g22160.1	upstream_gene_variant ; 3602.0bp to feature; MODIFIER	silent_mutation	Average:8.912; most accessible tissue: Callus, score: 19.391	N	N	N	N
vg1011449672	T -> C	LOC_Os10g22164.1	downstream_gene_variant ; 489.0bp to feature; MODIFIER	silent_mutation	Average:8.912; most accessible tissue: Callus, score: 19.391	N	N	N	N
vg1011449672	T -> C	LOC_Os10g22160-LOC_Os10g22164	intergenic_region ; MODIFIER	silent_mutation	Average:8.912; most accessible tissue: Callus, score: 19.391	N	N	N	N
vg1011449672	T -> DEL	N	N	silent_mutation	Average:8.912; most accessible tissue: Callus, score: 19.391	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1011449672	8.55E-06	3.81E-08	mr1457_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011449672	4.72E-06	2.94E-08	mr1458_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251