\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011368518:

Variant ID: vg1011368518 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11368518
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, C: 0.07, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:


AACTGTGGTGGGATTGGACGAGTCTTGATTCCCCCACTCAGCGGTAGCCCCTTTTCTCCTCCCGCCCTGTTTGCCGCACCTTGCTGCGGGTACGGTGTGG[T/C]
GAAAGGCAAAATCGCAGCTTGTGCGTGAGGTTGGGCCGTGGCATTCGACTGCCCGGTTCCAACTGGAGGTACTTGCTGAGCCACCATAGATGGGTCAAAA

Reverse complement sequence

TTTTGACCCATCTATGGTGGCTCAGCAAGTACCTCCAGTTGGAACCGGGCAGTCGAATGCCACGGCCCAACCTCACGCACAAGCTGCGATTTTGCCTTTC[A/G]
CCACACCGTACCCGCAGCAAGGTGCGGCAAACAGGGCGGGAGGAGAAAAGGGGCTACCGCTGAGTGGGGGAATCAAGACTCGTCCAATCCCACCACAGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 12.60% 9.40% 22.66% 55.31% NA
All Indica  2759 1.30% 12.30% 29.25% 57.23% NA
All Japonica  1512 35.50% 5.60% 10.85% 48.08% NA
Aus  269 1.50% 3.70% 22.68% 72.12% NA
Indica I  595 1.00% 7.90% 20.34% 70.76% NA
Indica II  465 1.70% 21.10% 29.68% 47.53% NA
Indica III  913 0.80% 12.30% 34.39% 52.57% NA
Indica Intermediate  786 1.80% 10.30% 29.77% 58.14% NA
Temperate Japonica  767 67.70% 0.40% 2.35% 29.60% NA
Tropical Japonica  504 1.00% 11.90% 21.03% 66.07% NA
Japonica Intermediate  241 5.40% 8.70% 16.60% 69.29% NA
VI/Aromatic  96 8.30% 6.20% 15.62% 69.79% NA
Intermediate  90 12.20% 8.90% 26.67% 52.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011368518 T -> C LOC_Os10g22010.1 missense_variant ; p.Thr477Ala; MODERATE nonsynonymous_codon ; T477A Average:13.026; most accessible tissue: Callus, score: 28.846 benign -0.586 TOLERATED 1.00
vg1011368518 T -> DEL LOC_Os10g22010.1 N frameshift_variant Average:13.026; most accessible tissue: Callus, score: 28.846 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011368518 NA 7.94E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 3.91E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 1.47E-08 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 4.16E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 3.33E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 1.68E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 5.74E-11 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 9.55E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 2.58E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 2.52E-06 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 1.15E-24 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 9.02E-08 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 3.50E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 3.01E-09 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 1.25E-09 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 9.28E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 4.04E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 6.06E-08 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 3.53E-08 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 1.36E-10 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 1.03E-07 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 5.96E-09 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 3.27E-11 mr1570_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 6.21E-07 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 3.60E-07 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 6.52E-24 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 6.09E-12 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 1.02E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 2.24E-07 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 2.38E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 2.35E-08 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 1.59E-06 mr1763_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 2.33E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 2.27E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 1.30E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 1.26E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011368518 NA 1.84E-13 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251