Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011365856:

Variant ID: vg1011365856 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 11365856
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGCTGCTTGGCACTCTGGTGTCCAATTAAACTTTCCTGCGCCCCGGAGGGTCTTCAAGAAGGGCAAACCTCTTTCGGCTGCCTTTGAGAGGAATCGACT[A/G]
AGTGCTGCAATTCAGCCTGCAAGCTTTTGTACTTCATGTACGCTTGACGGAGGCTTCATTTGCTGGATGGCATCGATTTTCTCGGGATTCGCCTCGATGC

Reverse complement sequence

GCATCGAGGCGAATCCCGAGAAAATCGATGCCATCCAGCAAATGAAGCCTCCGTCAAGCGTACATGAAGTACAAAAGCTTGCAGGCTGAATTGCAGCACT[T/C]
AGTCGATTCCTCTCAAAGGCAGCCGAAAGAGGTTTGCCCTTCTTGAAGACCCTCCGGGGCGCAGGAAAGTTTAATTGGACACCAGAGTGCCAAGCAGCAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.40%	0.80%	40.41%	31.38%	NA
All Indica	2759	15.50%	1.20%	65.42%	17.87%	NA
All Japonica	1512	37.50%	0.10%	2.58%	59.85%	NA
Aus	269	86.20%	0.70%	5.58%	7.43%	NA
Indica I	595	5.90%	1.00%	66.55%	26.55%	NA
Indica II	465	15.30%	0.40%	69.89%	14.41%	NA
Indica III	913	17.20%	1.90%	71.63%	9.31%	NA
Indica Intermediate	786	20.90%	1.10%	54.71%	23.28%	NA
Temperate Japonica	767	68.70%	0.00%	2.09%	29.20%	NA
Tropical Japonica	504	1.60%	0.20%	2.58%	95.63%	NA
Japonica Intermediate	241	13.30%	0.00%	4.15%	82.57%	NA
VI/Aromatic	96	37.50%	0.00%	18.75%	43.75%	NA
Intermediate	90	36.70%	1.10%	36.67%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1011365856	A -> G	LOC_Os10g22000.1	downstream_gene_variant ; 2859.0bp to feature; MODIFIER	silent_mutation	Average:9.875; most accessible tissue: Minghui63 root, score: 17.665	N	N	N	N
vg1011365856	A -> G	LOC_Os10g22010.1	intron_variant ; MODIFIER	silent_mutation	Average:9.875; most accessible tissue: Minghui63 root, score: 17.665	N	N	N	N
vg1011365856	A -> DEL	N	N	silent_mutation	Average:9.875; most accessible tissue: Minghui63 root, score: 17.665	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1011365856	NA	8.52E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011365856	NA	6.02E-06	mr1192	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011365856	NA	3.45E-08	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011365856	NA	3.02E-08	mr1826	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011365856	NA	8.30E-06	mr1112_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011365856	NA	6.75E-06	mr1194_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011365856	NA	1.61E-07	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011365856	NA	1.67E-06	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011365856	NA	4.05E-09	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011365856	NA	5.82E-06	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011365856	NA	1.66E-06	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011365856	NA	2.93E-07	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011365856	NA	2.79E-07	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011365856	NA	1.38E-09	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011365856	NA	9.81E-09	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011365856	NA	2.50E-09	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011365856	NA	9.97E-07	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011365856	NA	9.44E-12	mr1611_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011365856	NA	1.48E-07	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011365856	NA	2.23E-06	mr1693_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011365856	NA	8.42E-07	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011365856	NA	1.90E-06	mr1763_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011365856	NA	6.67E-06	mr1844_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011365856	NA	2.48E-08	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251