RiceVarMap2

Detailed information for vg1011363524:

Variant ID: vg1011363524 (JBrowse)

Variation Type: SNP

Chromosome: chr10

Position: 11363524

Reference Allele: G

Alternative Allele: A

Primary Allele: G

Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTGGTTCGGGCCTCCATGGTGAATAATAGCCCTACATTTAGTTTTTTTTTCTTTTTTCTCTCTTTCTTCTTTTTTTTTCTTGCCGAAAGGCTTTCATAGT[G/A]
CCGAAGGGCTTACATGACAGTATGTACATTTTTTCAATTTGGCAATTTGGGTGCCACCCATTCTAGACATAGAAGCGCTTGAGAGAGGCGGCGTTCTAGG

Reverse complement sequence

CCTAGAACGCCGCCTCTCTCAAGCGCTTCTATGTCTAGAATGGGTGGCACCCAAATTGCCAAATTGAAAAAATGTACATACTGTCATGTAAGCCCTTCGG[C/T]
ACTATGAAAGCCTTTCGGCAAGAAAAAAAAAGAAGAAAGAGAGAAAAAAGAAAAAAAAACTAAATGTAGGGCTATTATTCACCATGGAGGCCCGAACCAG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.70%	7.30%	8.29%	23.76%	NA
All Indica	2759	71.80%	12.10%	11.74%	4.35%	NA
All Japonica	1512	41.00%	0.30%	3.17%	55.49%	NA
Aus	269	71.40%	0.40%	1.49%	26.77%	NA
Indica I	595	83.40%	1.20%	5.88%	9.58%	NA
Indica II	465	72.70%	15.70%	11.18%	0.43%	NA
Indica III	913	65.80%	17.90%	15.01%	1.31%	NA
Indica Intermediate	786	69.60%	11.50%	12.72%	6.23%	NA
Temperate Japonica	767	71.20%	0.40%	1.83%	26.60%	NA
Tropical Japonica	504	7.70%	0.20%	2.58%	89.48%	NA
Japonica Intermediate	241	14.50%	0.40%	8.71%	76.35%	NA
VI/Aromatic	96	19.80%	2.10%	5.21%	72.92%	NA
Intermediate	90	61.10%	2.20%	12.22%	24.44%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1011363524	G -> A	LOC_Os10g22000.1	downstream_gene_variant ; 527.0bp to feature; MODIFIER	silent_mutation	Average:8.382; most accessible tissue: Callus, score: 16.929	N	N	N	N
vg1011363524	G -> A	LOC_Os10g22010.1	downstream_gene_variant ; 193.0bp to feature; MODIFIER	silent_mutation	Average:8.382; most accessible tissue: Callus, score: 16.929	N	N	N	N
vg1011363524	G -> A	LOC_Os10g22000-LOC_Os10g22010	intergenic_region ; MODIFIER	silent_mutation	Average:8.382; most accessible tissue: Callus, score: 16.929	N	N	N	N
vg1011363524	G -> DEL	N	N	silent_mutation	Average:8.382; most accessible tissue: Callus, score: 16.929	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1011363524	1.18E-06	1.18E-06	mr1027	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011363524	NA	1.14E-06	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 2 of 2 entries

Previous1Next

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg1011363524:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact