\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011340145:

Variant ID: vg1011340145 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11340145
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTCAATTTGAGAAGTTCAAGCACAAAGCACAACACCGTATAATCCTTGTCACATCCTTTCGATTCGTCGTAAAGAAGTTCCTTCGCTGCTTTTTCCAAC[T/G]
CTTCCCAATTGTTGAACCCTCGTCTTGTACTAGTTAGAACCTCTGGTTCAACGTGCTGCAACATATCCTCTAGATCAAAATCAATACCTGCATCATCTAT

Reverse complement sequence

ATAGATGATGCAGGTATTGATTTTGATCTAGAGGATATGTTGCAGCACGTTGAACCAGAGGTTCTAACTAGTACAAGACGAGGGTTCAACAATTGGGAAG[A/C]
GTTGGAAAAAGCAGCGAAGGAACTTCTTTACGACGAATCGAAAGGATGTGACAAGGATTATACGGTGTTGTGCTTTGTGCTTGAACTTCTCAAATTGAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.00% 21.20% 8.91% 28.93% NA
All Indica  2759 41.50% 13.90% 7.94% 36.64% NA
All Japonica  1512 37.60% 38.00% 9.26% 15.08% NA
Aus  269 36.40% 4.50% 20.07% 39.03% NA
Indica I  595 14.80% 18.30% 13.28% 53.61% NA
Indica II  465 12.50% 21.10% 11.83% 54.62% NA
Indica III  913 74.20% 6.90% 3.07% 15.88% NA
Indica Intermediate  786 41.00% 14.50% 7.25% 37.28% NA
Temperate Japonica  767 9.30% 64.80% 7.69% 18.25% NA
Tropical Japonica  504 72.60% 8.50% 9.92% 8.93% NA
Japonica Intermediate  241 54.80% 14.50% 12.86% 17.84% NA
VI/Aromatic  96 90.60% 7.30% 1.04% 1.04% NA
Intermediate  90 43.30% 24.40% 7.78% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011340145 T -> G LOC_Os10g21962.1 missense_variant ; p.Glu99Ala; MODERATE nonsynonymous_codon ; E99A Average:13.314; most accessible tissue: Callus, score: 43.088 possibly damaging -1.835 TOLERATED 1.00
vg1011340145 T -> DEL LOC_Os10g21962.1 N frameshift_variant Average:13.314; most accessible tissue: Callus, score: 43.088 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011340145 NA 3.01E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 7.40E-07 mr1263 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 3.64E-06 mr1263 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 7.40E-07 mr1451 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 3.64E-06 mr1451 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 3.65E-11 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 5.61E-11 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 4.59E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 1.48E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 9.04E-08 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 6.50E-08 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 4.80E-07 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 7.98E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 3.73E-07 mr1084_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 3.70E-10 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 8.42E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 5.14E-06 mr1094_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 1.88E-07 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 1.42E-07 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 6.02E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 8.55E-07 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 5.34E-08 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 7.33E-06 mr1205_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 1.86E-09 mr1206_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 3.12E-07 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 4.59E-09 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 8.09E-06 4.54E-12 mr1229_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 2.79E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 7.25E-07 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 3.59E-08 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 7.69E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 9.59E-07 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 8.24E-07 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 1.43E-10 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 9.59E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 1.79E-06 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 3.27E-06 3.27E-06 mr1418_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 2.13E-06 mr1419_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 4.43E-06 mr1420_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 6.72E-06 mr1482_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 8.78E-12 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 5.65E-06 mr1488_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 2.03E-09 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 1.07E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 7.19E-08 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 4.31E-06 mr1555_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 3.41E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 1.61E-08 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 2.92E-11 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 6.01E-06 mr1620_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 4.30E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 1.09E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 2.16E-07 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 3.06E-06 mr1729_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 7.94E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 7.35E-06 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 8.08E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 1.15E-08 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 4.93E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 3.58E-07 mr1763_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 5.89E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 9.26E-06 2.89E-06 mr1813_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 4.45E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 4.48E-09 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 1.64E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011340145 NA 1.02E-10 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251