Variant ID: vg1011340029 (JBrowse) | Variation Type: SNP |
Chromosome: chr10 | Position: 11340029 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GAACCTTTCAGAAGATCGGGAACCCTAGTGCACATCAGCAGGTTCGGTTTAGGAAGCATAACTCTCAGAAGATCCATCAAATCATTGAAGCTAGTGTCCG[A/G]
CCATCCATGTCTGGCCTTCAATTTGAGAAGTTCAAGCACAAAGCACAACACCGTATAATCCTTGTCACATCCTTTCGATTCGTCGTAAAGAAGTTCCTTC
GAAGGAACTTCTTTACGACGAATCGAAAGGATGTGACAAGGATTATACGGTGTTGTGCTTTGTGCTTGAACTTCTCAAATTGAAGGCCAGACATGGATGG[T/C]
CGGACACTAGCTTCAATGATTTGATGGATCTTCTGAGAGTTATGCTTCCTAAACCGAACCTGCTGATGTGCACTAGGGTTCCCGATCTTCTGAAAGGTTC
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 55.90% | 1.70% | 5.10% | 37.24% | NA |
All Indica | 2759 | 45.40% | 2.90% | 7.61% | 44.07% | NA |
All Japonica | 1512 | 74.80% | 0.10% | 1.52% | 23.61% | NA |
Aus | 269 | 39.40% | 0.00% | 2.60% | 57.99% | NA |
Indica I | 595 | 24.00% | 3.90% | 10.92% | 61.18% | NA |
Indica II | 465 | 16.10% | 4.50% | 12.90% | 66.45% | NA |
Indica III | 913 | 74.70% | 1.00% | 2.41% | 21.91% | NA |
Indica Intermediate | 786 | 44.90% | 3.40% | 8.02% | 43.64% | NA |
Temperate Japonica | 767 | 79.10% | 0.00% | 1.56% | 19.30% | NA |
Tropical Japonica | 504 | 74.40% | 0.20% | 0.79% | 24.60% | NA |
Japonica Intermediate | 241 | 61.80% | 0.00% | 2.90% | 35.27% | NA |
VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
Intermediate | 90 | 64.40% | 1.10% | 1.11% | 33.33% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1011340029 | A -> G | LOC_Os10g21962.1 | missense_variant ; p.Ser138Pro; MODERATE | nonsynonymous_codon ; S138L | Average:14.444; most accessible tissue: Callus, score: 52.537 | benign | 0.178 | TOLERATED | 0.07 |
vg1011340029 | A -> G | LOC_Os10g21962.1 | missense_variant ; p.Ser138Pro; MODERATE | nonsynonymous_codon ; S138P | Average:14.444; most accessible tissue: Callus, score: 52.537 | possibly damaging | 1.914 | DELETERIOUS | 0.00 |
vg1011340029 | A -> DEL | LOC_Os10g21962.1 | N | frameshift_variant | Average:14.444; most accessible tissue: Callus, score: 52.537 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1011340029 | NA | 4.22E-06 | mr1002 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1011340029 | NA | 8.97E-07 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1011340029 | NA | 3.89E-06 | mr1520 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1011340029 | NA | 1.37E-08 | mr1929 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1011340029 | NA | 2.97E-06 | mr1104_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1011340029 | NA | 1.94E-06 | mr1206_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1011340029 | 4.57E-06 | 9.72E-09 | mr1224_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1011340029 | NA | 6.30E-07 | mr1229_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1011340029 | NA | 1.38E-06 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1011340029 | NA | 6.64E-07 | mr1404_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1011340029 | NA | 8.91E-07 | mr1620_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |