\
| Variant ID: vg1011221880 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 11221880 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 327. )
TATCAGGCATAGTCCAATCGGCTACAAAGTCGGCAAGTACCTGGGACTTGATGGCTGTTCGTGGCACAAAGCGGACATCAAATTGGCTTAGCTCGACTAC[C/A]
CATTTCGCGATGCGGCCGACAACGTCTTTGTTTCTCACTACTTCACCGAGAGGGAAAGAGGATACAACTGTGACCCTGTGGGCTTCGAAGTAGTGGCGTA
TACGCCACTACTTCGAAGCCCACAGGGTCACAGTTGTATCCTCTTTCCCTCTCGGTGAAGTAGTGAGAAACAAAGACGTTGTCGGCCGCATCGCGAAATG[G/T]
GTAGTCGAGCTAAGCCAATTTGATGTCCGCTTTGTGCCACGAACAGCCATCAAGTCCCAGGTACTTGCCGACTTTGTAGCCGATTGGACTATGCCTGATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.50% | 14.60% | 2.20% | 4.72% | NA |
| All Indica | 2759 | 92.20% | 3.60% | 2.75% | 1.41% | NA |
| All Japonica | 1512 | 48.70% | 37.80% | 1.79% | 11.64% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 87.70% | 5.40% | 5.21% | 1.68% | NA |
| Indica II | 465 | 98.90% | 0.40% | 0.65% | 0.00% | NA |
| Indica III | 913 | 90.30% | 4.10% | 3.29% | 2.41% | NA |
| Indica Intermediate | 786 | 93.90% | 3.70% | 1.53% | 0.89% | NA |
| Temperate Japonica | 767 | 80.80% | 18.90% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 7.50% | 56.20% | 4.76% | 31.55% | NA |
| Japonica Intermediate | 241 | 32.80% | 59.80% | 1.24% | 6.22% | NA |
| VI/Aromatic | 96 | 92.70% | 6.20% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 78.90% | 13.30% | 1.11% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1011221880 | C -> A | LOC_Os10g21830.1 | missense_variant ; p.Trp208Cys; MODERATE | nonsynonymous_codon ; W208C | Average:50.711; most accessible tissue: Minghui63 flag leaf, score: 79.383 | probably damaging |
3.682 |
DELETERIOUS | 0.02 |
| vg1011221880 | C -> DEL | LOC_Os10g21830.1 | N | frameshift_variant | Average:50.711; most accessible tissue: Minghui63 flag leaf, score: 79.383 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1011221880 | 7.55E-07 | NA | mr1071 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011221880 | 2.37E-06 | NA | mr1140 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011221880 | 4.27E-06 | NA | mr1203 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011221880 | NA | 3.23E-07 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011221880 | NA | 1.42E-10 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011221880 | 8.50E-06 | NA | mr1395 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011221880 | NA | 1.06E-10 | mr1580 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011221880 | 4.95E-06 | NA | mr1618 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011221880 | NA | 5.96E-08 | mr1825 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011221880 | 5.40E-06 | NA | mr1203_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011221880 | NA | 6.38E-11 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011221880 | NA | 4.25E-07 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |