Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011152283:

Variant ID: vg1011152283 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 11152283
Reference Allele: A	Alternative Allele: G,T
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCCCAATTAAATCCTAATAAATTCCATTGGCCCACATTAAGTGCTATGGGTAATAATACCACCTTGAAAATCTAAGTGAAGATGTCTCAACTTAAATAC[A/G,T]
GAGCTAGTGGAGGGTCTTTGTTGACCGGTTGAGATGGTGCGCGGACAACCAAGCGGGGCGAGGCGAGGAGAGGCGAGGCAGACAGCTGCTGCGCTCTCTT

Reverse complement sequence

AAGAGAGCGCAGCAGCTGTCTGCCTCGCCTCTCCTCGCCTCGCCCCGCTTGGTTGTCCGCGCACCATCTCAACCGGTCAACAAAGACCCTCCACTAGCTC[T/C,A]
GTATTTAAGTTGAGACATCTTCACTTAGATTTTCAAGGTGGTATTATTACCCATAGCACTTAATGTGGGCCAATGGAATTTATTAGGATTTAATTGGGCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	18.20%	13.90%	12.51%	55.35%	T: 0.02%
All Indica	2759	2.10%	19.60%	14.28%	64.01%	T: 0.04%
All Japonica	1512	50.70%	6.60%	11.97%	30.69%	NA
Aus	269	1.50%	0.00%	1.49%	97.03%	NA
Indica I	595	5.50%	14.80%	15.80%	63.87%	NA
Indica II	465	1.50%	19.80%	9.46%	69.25%	NA
Indica III	913	0.40%	20.30%	15.77%	63.53%	NA
Indica Intermediate	786	1.70%	22.40%	14.25%	61.58%	T: 0.13%
Temperate Japonica	767	81.90%	2.00%	8.47%	7.69%	NA
Tropical Japonica	504	6.50%	13.90%	16.47%	63.10%	NA
Japonica Intermediate	241	44.00%	6.20%	13.69%	36.10%	NA
VI/Aromatic	96	11.50%	3.10%	0.00%	85.42%	NA
Intermediate	90	25.60%	13.30%	13.33%	47.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1011152283	A -> G	LOC_Os10g21720.1	upstream_gene_variant ; 2723.0bp to feature; MODIFIER	silent_mutation	Average:58.18; most accessible tissue: Zhenshan97 flag leaf, score: 78.259	N	N	N	N
vg1011152283	A -> G	LOC_Os10g21730.1	upstream_gene_variant ; 721.0bp to feature; MODIFIER	silent_mutation	Average:58.18; most accessible tissue: Zhenshan97 flag leaf, score: 78.259	N	N	N	N
vg1011152283	A -> G	LOC_Os10g21720-LOC_Os10g21730	intergenic_region ; MODIFIER	silent_mutation	Average:58.18; most accessible tissue: Zhenshan97 flag leaf, score: 78.259	N	N	N	N
vg1011152283	A -> T	LOC_Os10g21720.1	upstream_gene_variant ; 2723.0bp to feature; MODIFIER	silent_mutation	Average:58.18; most accessible tissue: Zhenshan97 flag leaf, score: 78.259	N	N	N	N
vg1011152283	A -> T	LOC_Os10g21730.1	upstream_gene_variant ; 721.0bp to feature; MODIFIER	silent_mutation	Average:58.18; most accessible tissue: Zhenshan97 flag leaf, score: 78.259	N	N	N	N
vg1011152283	A -> T	LOC_Os10g21720-LOC_Os10g21730	intergenic_region ; MODIFIER	silent_mutation	Average:58.18; most accessible tissue: Zhenshan97 flag leaf, score: 78.259	N	N	N	N
vg1011152283	A -> DEL	N	N	silent_mutation	Average:58.18; most accessible tissue: Zhenshan97 flag leaf, score: 78.259	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1011152283	3.06E-06	NA	mr1070	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011152283	NA	4.95E-36	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011152283	NA	6.19E-07	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011152283	NA	7.36E-41	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011152283	NA	4.81E-31	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011152283	NA	2.26E-07	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011152283	NA	1.60E-07	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251