\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011143178:

Variant ID: vg1011143178 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11143178
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


GTTAGTCACACCACCGTTCGTGGGCGTCTACATTTTCACCCACCAGCTTGCCTTCGCCGCCGCCGACTGGAGTCTCCGCCTACACGGCAGGCTCATTATG[C/T]
CGCCGTTGTTGGGCGTCTACGACTTCACCACCGGCCTGCCTCCGTCGCCGCCGACTGGTGTCCTCGCCTATACGGTTCGTTGGTCACACCACTGTTCATG

Reverse complement sequence

CATGAACAGTGGTGTGACCAACGAACCGTATAGGCGAGGACACCAGTCGGCGGCGACGGAGGCAGGCCGGTGGTGAAGTCGTAGACGCCCAACAACGGCG[G/A]
CATAATGAGCCTGCCGTGTAGGCGGAGACTCCAGTCGGCGGCGGCGAAGGCAAGCTGGTGGGTGAAAATGTAGACGCCCACGAACGGTGGTGTGACTAAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.70% 18.40% 0.99% 8.91% NA
All Indica  2759 93.40% 2.40% 1.45% 2.75% NA
All Japonica  1512 49.00% 50.40% 0.07% 0.53% NA
Aus  269 1.90% 1.90% 1.49% 94.80% NA
Indica I  595 92.80% 5.40% 0.00% 1.85% NA
Indica II  465 97.60% 1.50% 0.43% 0.43% NA
Indica III  913 93.90% 0.50% 2.74% 2.85% NA
Indica Intermediate  786 90.80% 2.80% 1.65% 4.71% NA
Temperate Japonica  767 18.50% 81.50% 0.00% 0.00% NA
Tropical Japonica  504 93.10% 6.30% 0.20% 0.40% NA
Japonica Intermediate  241 53.90% 43.60% 0.00% 2.49% NA
VI/Aromatic  96 14.60% 12.50% 1.04% 71.88% NA
Intermediate  90 57.80% 26.70% 1.11% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011143178 C -> T LOC_Os10g21720.1 downstream_gene_variant ; 3883.0bp to feature; MODIFIER silent_mutation Average:70.653; most accessible tissue: Zhenshan97 flag leaf, score: 85.88 N N N N
vg1011143178 C -> T LOC_Os10g21700-LOC_Os10g21720 intergenic_region ; MODIFIER silent_mutation Average:70.653; most accessible tissue: Zhenshan97 flag leaf, score: 85.88 N N N N
vg1011143178 C -> DEL N N silent_mutation Average:70.653; most accessible tissue: Zhenshan97 flag leaf, score: 85.88 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1011143178 C T -0.01 -0.01 0.0 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011143178 NA 3.00E-08 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011143178 3.28E-06 3.28E-06 mr1385 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011143178 NA 6.56E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011143178 NA 3.88E-08 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011143178 NA 8.78E-11 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011143178 NA 7.28E-08 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011143178 NA 3.19E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251