Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011141500:

Variant ID: vg1011141500 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 11141500
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCCGCCTACTGGTGTCTCTGCCTACACGGCTAGCCTATTATGCCTCCGTTGGTGGGCATTTTCGCTTTCACCGTCGACCGCCTTCGTCGCCGCCGACTG[T/G]
TGTCTTCATTGTTATTGATGGATGACTTTGTTCCCACATTGGCCACCTCTGCCATCACCAAGGGGAATATTGCAAAGCTAAGTCATCATTTATTTCATTC

Reverse complement sequence

GAATGAAATAAATGATGACTTAGCTTTGCAATATTCCCCTTGGTGATGGCAGAGGTGGCCAATGTGGGAACAAAGTCATCCATCAATAACAATGAAGACA[A/C]
CAGTCGGCGGCGACGAAGGCGGTCGACGGTGAAAGCGAAAATGCCCACCAACGGAGGCATAATAGGCTAGCCGTGTAGGCAGAGACACCAGTAGGCGGCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.00%	17.90%	0.04%	9.99%	NA
All Indica	2759	94.00%	1.70%	0.00%	4.31%	NA
All Japonica	1512	49.10%	50.40%	0.00%	0.53%	NA
Aus	269	1.90%	1.50%	0.00%	96.65%	NA
Indica I	595	92.90%	5.20%	0.00%	1.85%	NA
Indica II	465	98.10%	1.30%	0.00%	0.65%	NA
Indica III	913	94.20%	0.10%	0.00%	5.70%	NA
Indica Intermediate	786	92.20%	1.00%	0.00%	6.74%	NA
Temperate Japonica	767	18.50%	81.50%	0.00%	0.00%	NA
Tropical Japonica	504	93.30%	6.30%	0.00%	0.40%	NA
Japonica Intermediate	241	53.90%	43.60%	0.00%	2.49%	NA
VI/Aromatic	96	14.60%	11.50%	0.00%	73.96%	NA
Intermediate	90	55.60%	26.70%	2.22%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1011141500	T -> G	LOC_Os10g21700-LOC_Os10g21720	intergenic_region ; MODIFIER	silent_mutation	Average:55.382; most accessible tissue: Zhenshan97 flag leaf, score: 73.822	N	N	N	N
vg1011141500	T -> DEL	N	N	silent_mutation	Average:55.382; most accessible tissue: Zhenshan97 flag leaf, score: 73.822	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1011141500	2.88E-06	NA	mr1070	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011141500	NA	1.77E-35	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011141500	NA	5.19E-07	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011141500	NA	5.67E-40	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011141500	NA	1.09E-10	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011141500	NA	1.22E-31	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011141500	NA	5.90E-06	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011141500	NA	7.01E-15	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251