\
| Variant ID: vg1011141500 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 11141500 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGCCGCCTACTGGTGTCTCTGCCTACACGGCTAGCCTATTATGCCTCCGTTGGTGGGCATTTTCGCTTTCACCGTCGACCGCCTTCGTCGCCGCCGACTG[T/G]
TGTCTTCATTGTTATTGATGGATGACTTTGTTCCCACATTGGCCACCTCTGCCATCACCAAGGGGAATATTGCAAAGCTAAGTCATCATTTATTTCATTC
GAATGAAATAAATGATGACTTAGCTTTGCAATATTCCCCTTGGTGATGGCAGAGGTGGCCAATGTGGGAACAAAGTCATCCATCAATAACAATGAAGACA[A/C]
CAGTCGGCGGCGACGAAGGCGGTCGACGGTGAAAGCGAAAATGCCCACCAACGGAGGCATAATAGGCTAGCCGTGTAGGCAGAGACACCAGTAGGCGGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.00% | 17.90% | 0.04% | 9.99% | NA |
| All Indica | 2759 | 94.00% | 1.70% | 0.00% | 4.31% | NA |
| All Japonica | 1512 | 49.10% | 50.40% | 0.00% | 0.53% | NA |
| Aus | 269 | 1.90% | 1.50% | 0.00% | 96.65% | NA |
| Indica I | 595 | 92.90% | 5.20% | 0.00% | 1.85% | NA |
| Indica II | 465 | 98.10% | 1.30% | 0.00% | 0.65% | NA |
| Indica III | 913 | 94.20% | 0.10% | 0.00% | 5.70% | NA |
| Indica Intermediate | 786 | 92.20% | 1.00% | 0.00% | 6.74% | NA |
| Temperate Japonica | 767 | 18.50% | 81.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 93.30% | 6.30% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 53.90% | 43.60% | 0.00% | 2.49% | NA |
| VI/Aromatic | 96 | 14.60% | 11.50% | 0.00% | 73.96% | NA |
| Intermediate | 90 | 55.60% | 26.70% | 2.22% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1011141500 | T -> G | LOC_Os10g21700-LOC_Os10g21720 | intergenic_region ; MODIFIER | silent_mutation | Average:55.382; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 | N | N | N | N |
| vg1011141500 | T -> DEL | N | N | silent_mutation | Average:55.382; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1011141500 | 2.88E-06 | NA | mr1070 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011141500 | NA | 1.77E-35 | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011141500 | NA | 5.19E-07 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011141500 | NA | 5.67E-40 | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011141500 | NA | 1.09E-10 | mr1959 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011141500 | NA | 1.22E-31 | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011141500 | NA | 5.90E-06 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011141500 | NA | 7.01E-15 | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |