Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011122210:

Variant ID: vg1011122210 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 11122210
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTGGAGGAGAATGCGGGGTAGATTTATAGGGGCTCGGGAGGGGCGGACATGGCCGGGAGGTGGCCGGATTTCTCTCCGACATGGGAGAGGAGAGAGAGAC[A/G]
GGGGGACTGGGATTCGAAAACCGAATCCCGCGCTCTCCACGAGTGTGGCGCGGGCGGAGATGTGGTGTGGGGCGTGGAGCGCTCAACCATCCAACTTTTG

Reverse complement sequence

CAAAAGTTGGATGGTTGAGCGCTCCACGCCCCACACCACATCTCCGCCCGCGCCACACTCGTGGAGAGCGCGGGATTCGGTTTTCGAATCCCAGTCCCCC[T/C]
GTCTCTCTCTCCTCTCCCATGTCGGAGAGAAATCCGGCCACCTCCCGGCCATGTCCGCCCCTCCCGAGCCCCTATAAATCTACCCCGCATTCTCCTCCAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.60%	21.30%	0.04%	0.00%	NA
All Indica	2759	96.00%	3.90%	0.07%	0.00%	NA
All Japonica	1512	42.70%	57.30%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	89.90%	9.70%	0.34%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	95.30%	4.70%	0.00%	0.00%	NA
Temperate Japonica	767	9.10%	90.90%	0.00%	0.00%	NA
Tropical Japonica	504	92.90%	7.10%	0.00%	0.00%	NA
Japonica Intermediate	241	44.40%	55.60%	0.00%	0.00%	NA
VI/Aromatic	96	88.50%	11.50%	0.00%	0.00%	NA
Intermediate	90	74.40%	25.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1011122210	A -> G	LOC_Os10g21690.1	upstream_gene_variant ; 547.0bp to feature; MODIFIER	silent_mutation	Average:62.356; most accessible tissue: Zhenshan97 young leaf, score: 88.259	N	N	N	N
vg1011122210	A -> G	LOC_Os10g21700.1	upstream_gene_variant ; 2184.0bp to feature; MODIFIER	silent_mutation	Average:62.356; most accessible tissue: Zhenshan97 young leaf, score: 88.259	N	N	N	N
vg1011122210	A -> G	LOC_Os10g21690-LOC_Os10g21700	intergenic_region ; MODIFIER	silent_mutation	Average:62.356; most accessible tissue: Zhenshan97 young leaf, score: 88.259	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1011122210	NA	1.69E-07	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210	NA	8.47E-06	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210	6.95E-06	1.94E-24	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210	NA	1.59E-06	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210	7.26E-07	9.57E-40	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210	NA	4.34E-09	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210	NA	3.14E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210	NA	4.90E-10	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210	NA	6.07E-08	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210	7.30E-08	2.75E-45	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210	NA	8.10E-10	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210	NA	5.39E-12	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210	NA	3.80E-06	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210	8.49E-09	8.56E-41	mr1310_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210	NA	5.51E-09	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210	NA	1.22E-07	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210	NA	3.11E-39	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210	NA	5.25E-11	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210	NA	9.71E-07	mr1705_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210	4.89E-09	6.73E-21	mr1959_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210	NA	1.39E-06	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251