\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011122210:

Variant ID: vg1011122210 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11122210
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGGAGGAGAATGCGGGGTAGATTTATAGGGGCTCGGGAGGGGCGGACATGGCCGGGAGGTGGCCGGATTTCTCTCCGACATGGGAGAGGAGAGAGAGAC[A/G]
GGGGGACTGGGATTCGAAAACCGAATCCCGCGCTCTCCACGAGTGTGGCGCGGGCGGAGATGTGGTGTGGGGCGTGGAGCGCTCAACCATCCAACTTTTG

Reverse complement sequence

CAAAAGTTGGATGGTTGAGCGCTCCACGCCCCACACCACATCTCCGCCCGCGCCACACTCGTGGAGAGCGCGGGATTCGGTTTTCGAATCCCAGTCCCCC[T/C]
GTCTCTCTCTCCTCTCCCATGTCGGAGAGAAATCCGGCCACCTCCCGGCCATGTCCGCCCCTCCCGAGCCCCTATAAATCTACCCCGCATTCTCCTCCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.60% 21.30% 0.04% 0.00% NA
All Indica  2759 96.00% 3.90% 0.07% 0.00% NA
All Japonica  1512 42.70% 57.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 89.90% 9.70% 0.34% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 95.30% 4.70% 0.00% 0.00% NA
Temperate Japonica  767 9.10% 90.90% 0.00% 0.00% NA
Tropical Japonica  504 92.90% 7.10% 0.00% 0.00% NA
Japonica Intermediate  241 44.40% 55.60% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011122210 A -> G LOC_Os10g21690.1 upstream_gene_variant ; 547.0bp to feature; MODIFIER silent_mutation Average:62.356; most accessible tissue: Zhenshan97 young leaf, score: 88.259 N N N N
vg1011122210 A -> G LOC_Os10g21700.1 upstream_gene_variant ; 2184.0bp to feature; MODIFIER silent_mutation Average:62.356; most accessible tissue: Zhenshan97 young leaf, score: 88.259 N N N N
vg1011122210 A -> G LOC_Os10g21690-LOC_Os10g21700 intergenic_region ; MODIFIER silent_mutation Average:62.356; most accessible tissue: Zhenshan97 young leaf, score: 88.259 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011122210 NA 1.69E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210 NA 8.47E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210 6.95E-06 1.94E-24 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210 NA 1.59E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210 7.26E-07 9.57E-40 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210 NA 4.34E-09 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210 NA 3.14E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210 NA 4.90E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210 NA 6.07E-08 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210 7.30E-08 2.75E-45 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210 NA 8.10E-10 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210 NA 5.39E-12 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210 NA 3.80E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210 8.49E-09 8.56E-41 mr1310_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210 NA 5.51E-09 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210 NA 1.22E-07 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210 NA 3.11E-39 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210 NA 5.25E-11 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210 NA 9.71E-07 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210 4.89E-09 6.73E-21 mr1959_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011122210 NA 1.39E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251