\
| Variant ID: vg1011080958 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 11080958 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCCTCCCCACCGCCGCCACTAAGTCTCTCGACCTGCACCACCTGATCATCCCCTCTCGAGGCCAGCCGGCTGTGGATCCGCGAGGGAGGCAGCGAGGCCC[A/G]
TCCGCCGTCACCGTCGCTGACCTCCTCCGCCGCCACCGGATCCGCCCCTATCGTGGCCAACTGGTTGCAGATCCAACCTCTTCATTGACCTGCCGTATGA
TCATACGGCAGGTCAATGAAGAGGTTGGATCTGCAACCAGTTGGCCACGATAGGGGCGGATCCGGTGGCGGCGGAGGAGGTCAGCGACGGTGACGGCGGA[T/C]
GGGCCTCGCTGCCTCCCTCGCGGATCCACAGCCGGCTGGCCTCGAGAGGGGATGATCAGGTGGTGCAGGTCGAGAGACTTAGTGGCGGCGGTGGGGAGGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.90% | 20.10% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 42.60% | 57.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 9.60% | 90.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 92.30% | 7.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 43.60% | 56.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 26.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1011080958 | A -> G | LOC_Os10g21630.1 | upstream_gene_variant ; 2439.0bp to feature; MODIFIER | silent_mutation | Average:66.825; most accessible tissue: Zhenshan97 young leaf, score: 87.153 | N | N | N | N |
| vg1011080958 | A -> G | LOC_Os10g21640.1 | downstream_gene_variant ; 3240.0bp to feature; MODIFIER | silent_mutation | Average:66.825; most accessible tissue: Zhenshan97 young leaf, score: 87.153 | N | N | N | N |
| vg1011080958 | A -> G | LOC_Os10g21630-LOC_Os10g21640 | intergenic_region ; MODIFIER | silent_mutation | Average:66.825; most accessible tissue: Zhenshan97 young leaf, score: 87.153 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1011080958 | NA | 1.41E-07 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011080958 | 9.31E-07 | 7.96E-26 | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011080958 | NA | 1.27E-06 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011080958 | 7.00E-08 | 2.61E-42 | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011080958 | NA | 1.24E-08 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011080958 | NA | 1.73E-06 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011080958 | NA | 2.99E-08 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011080958 | NA | 3.67E-21 | mr1679 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011080958 | NA | 2.35E-08 | mr1691 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011080958 | NA | 6.88E-09 | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011080958 | NA | 3.43E-17 | mr1768 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011080958 | 8.54E-09 | 4.62E-48 | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011080958 | NA | 1.55E-09 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011080958 | 1.83E-07 | 3.77E-13 | mr1959 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011080958 | NA | 2.61E-30 | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011080958 | NA | 4.03E-06 | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011080958 | 3.43E-06 | 5.97E-38 | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011080958 | NA | 1.12E-08 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011080958 | NA | 9.55E-08 | mr1495_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011080958 | NA | 2.22E-38 | mr1533_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011080958 | NA | 1.99E-17 | mr1682_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011080958 | NA | 2.14E-06 | mr1705_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011080958 | 3.96E-08 | 2.60E-19 | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011080958 | NA | 4.97E-07 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |