\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011078204:

Variant ID: vg1011078204 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11078204
Reference Allele: CAlternative Allele: T,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TGAAACGATGATTAGAACTAGGAAAAAAGTCCAAATACAAATTTAGATGAAAGCCCGTCTAGGACCCTAAACTTTAAAACCGGATATTTAACCCCCTAAA[C/T,A]
TTTACAATACCGTCTATATAACCCCTTAGGATGGTTTTGAATATTTTGGAAGCTTAAACGAACAATTTTGAATAACTAATATAATATATTTGCATACATC

Reverse complement sequence

GATGTATGCAAATATATTATATTAGTTATTCAAAATTGTTCGTTTAAGCTTCCAAAATATTCAAAACCATCCTAAGGGGTTATATAGACGGTATTGTAAA[G/A,T]
TTTAGGGGGTTAAATATCCGGTTTTAAAGTTTAGGGTCCTAGACGGGCTTTCATCTAAATTTGTATTTGGACTTTTTTCCTAGTTCTAATCATCGTTTCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 27.40% 0.15% 9.59% A: 0.02%
All Indica  2759 82.60% 13.70% 0.14% 3.59% A: 0.04%
All Japonica  1512 41.30% 58.00% 0.07% 0.60% NA
Aus  269 3.00% 1.10% 0.00% 95.91% NA
Indica I  595 76.60% 21.30% 0.17% 1.85% NA
Indica II  465 96.10% 3.20% 0.00% 0.65% NA
Indica III  913 82.40% 14.20% 0.00% 3.40% NA
Indica Intermediate  786 79.30% 13.40% 0.38% 6.87% A: 0.13%
Temperate Japonica  767 9.00% 90.90% 0.13% 0.00% NA
Tropical Japonica  504 91.10% 8.50% 0.00% 0.40% NA
Japonica Intermediate  241 40.20% 56.80% 0.00% 2.90% NA
VI/Aromatic  96 13.50% 8.30% 2.08% 76.04% NA
Intermediate  90 53.30% 31.10% 0.00% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011078204 C -> T LOC_Os10g21620.1 upstream_gene_variant ; 3247.0bp to feature; MODIFIER silent_mutation Average:44.219; most accessible tissue: Callus, score: 65.733 N N N N
vg1011078204 C -> T LOC_Os10g21630.1 intron_variant ; MODIFIER silent_mutation Average:44.219; most accessible tissue: Callus, score: 65.733 N N N N
vg1011078204 C -> A LOC_Os10g21620.1 upstream_gene_variant ; 3247.0bp to feature; MODIFIER silent_mutation Average:44.219; most accessible tissue: Callus, score: 65.733 N N N N
vg1011078204 C -> A LOC_Os10g21630.1 intron_variant ; MODIFIER silent_mutation Average:44.219; most accessible tissue: Callus, score: 65.733 N N N N
vg1011078204 C -> DEL N N silent_mutation Average:44.219; most accessible tissue: Callus, score: 65.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011078204 NA 2.34E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011078204 NA 3.37E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011078204 NA 1.71E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011078204 NA 1.44E-08 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011078204 NA 6.86E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011078204 NA 1.14E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011078204 NA 1.80E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011078204 NA 3.31E-08 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011078204 NA 8.31E-09 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011078204 NA 2.52E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011078204 NA 3.06E-08 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011078204 NA 8.90E-07 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011078204 NA 9.35E-10 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011078204 NA 4.74E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011078204 NA 4.43E-08 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011078204 7.50E-06 3.42E-06 mr1323_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011078204 NA 1.17E-07 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011078204 NA 2.80E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011078204 NA 1.57E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011078204 NA 1.55E-13 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011078204 NA 3.46E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251