Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1011075710:

Variant ID: vg1011075710 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 11075710
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

CAATAAGATAATAAGCCAATGTCAATAGGGTTTTAAACAATCGACTATATATCCGATGTAGATTCTGACAATGGAAGAACTTGGAACAAACAATCCAATC[G/A]
ACTGATAATAATATGAGAAAGTAGATGTCCAATGAACCAGTCGACCGATATCAATATAGAATATGAAATGTAGGCTCGTTGGTTAAAACATACATCGGCT

Reverse complement sequence

AGCCGATGTATGTTTTAACCAACGAGCCTACATTTCATATTCTATATTGATATCGGTCGACTGGTTCATTGGACATCTACTTTCTCATATTATTATCAGT[C/T]
GATTGGATTGTTTGTTCCAAGTTCTTCCATTGTCAGAATCTACATCGGATATATAGTCGATTGTTTAAAACCCTATTGACATTGGCTTATTATCTTATTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.10%	39.40%	0.06%	9.44%	NA
All Indica	2759	30.70%	65.70%	0.04%	3.59%	NA
All Japonica	1512	98.40%	1.00%	0.07%	0.53%	NA
Aus	269	3.30%	1.90%	0.37%	94.42%	NA
Indica I	595	33.10%	64.90%	0.17%	1.85%	NA
Indica II	465	14.40%	84.90%	0.00%	0.65%	NA
Indica III	913	34.10%	62.50%	0.00%	3.40%	NA
Indica Intermediate	786	34.50%	58.70%	0.00%	6.87%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	98.20%	1.40%	0.00%	0.40%	NA
Japonica Intermediate	241	95.40%	1.70%	0.41%	2.49%	NA
VI/Aromatic	96	21.90%	4.20%	0.00%	73.96%	NA
Intermediate	90	57.80%	26.70%	0.00%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1011075710	G -> A	LOC_Os10g21620.1	upstream_gene_variant ; 753.0bp to feature; MODIFIER	silent_mutation	Average:45.776; most accessible tissue: Callus, score: 81.81	N	N	N	N
vg1011075710	G -> A	LOC_Os10g21630.1	downstream_gene_variant ; 2077.0bp to feature; MODIFIER	silent_mutation	Average:45.776; most accessible tissue: Callus, score: 81.81	N	N	N	N
vg1011075710	G -> A	LOC_Os10g21620-LOC_Os10g21630	intergenic_region ; MODIFIER	silent_mutation	Average:45.776; most accessible tissue: Callus, score: 81.81	N	N	N	N
vg1011075710	G -> DEL	N	N	silent_mutation	Average:45.776; most accessible tissue: Callus, score: 81.81	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1011075710	NA	2.04E-10	mr1212_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011075710	NA	7.63E-17	mr1870_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011075710	NA	4.86E-07	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251