Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1011049314:

Variant ID: vg1011049314 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 11049314
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAAATCATCATCTGGGAGACCTTTTCTAAGAAGGGTAATTTGAAACCATGCCATTATAATTTTGCAAAGTTTGAGATATGCCATCGGTATCTCAATGACA[T/C]
GTAGGACCCACATGAGTCAATAACAGCATATATCAAATTTTGTAAAATTATAATGGCATGGTTTCAATTTTCCCTTTTAAGAAAGGGTGGTTATAAAGTA

Reverse complement sequence

TACTTTATAACCACCCTTTCTTAAAAGGGAAAATTGAAACCATGCCATTATAATTTTACAAAATTTGATATATGCTGTTATTGACTCATGTGGGTCCTAC[A/G]
TGTCATTGAGATACCGATGGCATATCTCAAACTTTGCAAAATTATAATGGCATGGTTTCAAATTACCCTTCTTAGAAAAGGTCTCCCAGATGATGATTTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.60%	14.30%	0.02%	0.00%	NA
All Indica	2759	98.20%	1.80%	0.00%	0.00%	NA
All Japonica	1512	60.30%	39.60%	0.07%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	95.90%	4.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.50%	1.50%	0.00%	0.00%	NA
Temperate Japonica	767	91.50%	8.50%	0.00%	0.00%	NA
Tropical Japonica	504	11.70%	88.10%	0.20%	0.00%	NA
Japonica Intermediate	241	62.70%	37.30%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1011049314	T -> C	LOC_Os10g21574.1	downstream_gene_variant ; 2600.0bp to feature; MODIFIER	silent_mutation	Average:71.721; most accessible tissue: Zhenshan97 root, score: 91.211	N	N	N	N
vg1011049314	T -> C	LOC_Os10g21590.1	downstream_gene_variant ; 3722.0bp to feature; MODIFIER	silent_mutation	Average:71.721; most accessible tissue: Zhenshan97 root, score: 91.211	N	N	N	N
vg1011049314	T -> C	LOC_Os10g21590.2	downstream_gene_variant ; 3767.0bp to feature; MODIFIER	silent_mutation	Average:71.721; most accessible tissue: Zhenshan97 root, score: 91.211	N	N	N	N
vg1011049314	T -> C	LOC_Os10g21560-LOC_Os10g21574	intergenic_region ; MODIFIER	silent_mutation	Average:71.721; most accessible tissue: Zhenshan97 root, score: 91.211	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1011049314	NA	2.30E-07	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011049314	NA	3.17E-08	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011049314	NA	1.07E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011049314	NA	1.24E-19	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011049314	NA	1.60E-12	mr1580	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011049314	NA	1.99E-17	mr1825	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011049314	NA	7.21E-10	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011049314	NA	4.84E-08	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011049314	NA	3.76E-06	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011049314	NA	1.35E-07	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011049314	NA	4.59E-10	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011049314	NA	4.11E-07	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011049314	NA	4.67E-08	mr1510_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011049314	NA	6.68E-10	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011049314	NA	7.23E-06	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251