| Variant ID: vg1011049314 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 11049314 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CAAATCATCATCTGGGAGACCTTTTCTAAGAAGGGTAATTTGAAACCATGCCATTATAATTTTGCAAAGTTTGAGATATGCCATCGGTATCTCAATGACA[T/C]
GTAGGACCCACATGAGTCAATAACAGCATATATCAAATTTTGTAAAATTATAATGGCATGGTTTCAATTTTCCCTTTTAAGAAAGGGTGGTTATAAAGTA
TACTTTATAACCACCCTTTCTTAAAAGGGAAAATTGAAACCATGCCATTATAATTTTACAAAATTTGATATATGCTGTTATTGACTCATGTGGGTCCTAC[A/G]
TGTCATTGAGATACCGATGGCATATCTCAAACTTTGCAAAATTATAATGGCATGGTTTCAAATTACCCTTCTTAGAAAAGGTCTCCCAGATGATGATTTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.60% | 14.30% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 60.30% | 39.60% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 91.50% | 8.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 11.70% | 88.10% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 62.70% | 37.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1011049314 | T -> C | LOC_Os10g21574.1 | downstream_gene_variant ; 2600.0bp to feature; MODIFIER | silent_mutation | Average:71.721; most accessible tissue: Zhenshan97 root, score: 91.211 | N | N | N | N |
| vg1011049314 | T -> C | LOC_Os10g21590.1 | downstream_gene_variant ; 3722.0bp to feature; MODIFIER | silent_mutation | Average:71.721; most accessible tissue: Zhenshan97 root, score: 91.211 | N | N | N | N |
| vg1011049314 | T -> C | LOC_Os10g21590.2 | downstream_gene_variant ; 3767.0bp to feature; MODIFIER | silent_mutation | Average:71.721; most accessible tissue: Zhenshan97 root, score: 91.211 | N | N | N | N |
| vg1011049314 | T -> C | LOC_Os10g21560-LOC_Os10g21574 | intergenic_region ; MODIFIER | silent_mutation | Average:71.721; most accessible tissue: Zhenshan97 root, score: 91.211 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1011049314 | NA | 2.30E-07 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011049314 | NA | 3.17E-08 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011049314 | NA | 1.07E-06 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011049314 | NA | 1.24E-19 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011049314 | NA | 1.60E-12 | mr1580 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011049314 | NA | 1.99E-17 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011049314 | NA | 7.21E-10 | mr1825 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011049314 | NA | 4.84E-08 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011049314 | NA | 3.76E-06 | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011049314 | NA | 1.35E-07 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/