\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011003657:

Variant ID: vg1011003657 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11003657
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CTGCGTGAGGGCGAGGGCGGCGGTGGCGGTGGCGTCTGGCGGGGACCGAAGTGGCAACGGCCGGCGCGAGGCGGGCACTGGAGTGTCCACCACCCCCTCC[C/T]
ACTCCGCCTCGCCACCTCCATGTCGTCGTCGTCGTCGTCTGCATGTCCTTCCCCCTCTCCCGTTGCTCCAGCCTCCATCTCCGTCTCCTCCGCCATCGAA

Reverse complement sequence

TTCGATGGCGGAGGAGACGGAGATGGAGGCTGGAGCAACGGGAGAGGGGGAAGGACATGCAGACGACGACGACGACGACATGGAGGTGGCGAGGCGGAGT[G/A]
GGAGGGGGTGGTGGACACTCCAGTGCCCGCCTCGCGCCGGCCGTTGCCACTTCGGTCCCCGCCAGACGCCACCGCCACCGCCGCCCTCGCCCTCACGCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.10% 6.20% 0.25% 3.43% NA
All Indica  2759 90.80% 3.20% 0.40% 5.62% NA
All Japonica  1512 86.40% 13.40% 0.07% 0.20% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.00% 0.70% 0.00% 0.34% NA
Indica II  465 93.80% 0.00% 0.43% 5.81% NA
Indica III  913 87.30% 4.80% 0.66% 7.23% NA
Indica Intermediate  786 87.00% 5.00% 0.38% 7.63% NA
Temperate Japonica  767 81.50% 18.40% 0.13% 0.00% NA
Tropical Japonica  504 96.40% 3.20% 0.00% 0.40% NA
Japonica Intermediate  241 80.90% 18.70% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 5.60% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011003657 C -> T LOC_Os10g21479.1 upstream_gene_variant ; 145.0bp to feature; MODIFIER silent_mutation Average:77.465; most accessible tissue: Zhenshan97 young leaf, score: 93.028 N N N N
vg1011003657 C -> T LOC_Os10g21490.1 downstream_gene_variant ; 3599.0bp to feature; MODIFIER silent_mutation Average:77.465; most accessible tissue: Zhenshan97 young leaf, score: 93.028 N N N N
vg1011003657 C -> T LOC_Os10g21479-LOC_Os10g21490 intergenic_region ; MODIFIER silent_mutation Average:77.465; most accessible tissue: Zhenshan97 young leaf, score: 93.028 N N N N
vg1011003657 C -> DEL N N silent_mutation Average:77.465; most accessible tissue: Zhenshan97 young leaf, score: 93.028 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1011003657 C T 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011003657 NA 1.42E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003657 9.13E-06 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003657 NA 3.83E-07 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003657 NA 2.26E-08 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003657 3.05E-06 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003657 NA 4.72E-07 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003657 9.24E-06 9.24E-06 mr1166_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003657 3.82E-06 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003657 6.57E-06 2.94E-08 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003657 6.14E-06 NA mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003657 6.48E-06 NA mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003657 NA 1.14E-06 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003657 NA 4.87E-06 mr1439_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003657 8.56E-06 NA mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003657 4.03E-07 1.18E-06 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003657 1.85E-09 1.53E-07 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003657 1.13E-08 1.28E-12 mr1585_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003657 NA 4.82E-06 mr1703_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003657 2.76E-08 NA mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003657 1.86E-08 8.77E-11 mr1765_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251