Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011002863:

Variant ID: vg1011002863 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 11002863
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

TATTTTTTTTGAAAATACTGACAATGTAACAAACAGATTAAGTCACGGATCAAACGGAAACCTAATGGGAGGGGCATGGAAGGAATCAAAGTGAAAAATT[T/C]
GGGGGTACAGAGAGGATTGAGTAAAATTCGAGGGTATGTAAGGGATTAGGTGAGTTTTTATGGGTACACAAGGGATTTTCTTTTTGAGGGAAACTACTGC

Reverse complement sequence

GCAGTAGTTTCCCTCAAAAAGAAAATCCCTTGTGTACCCATAAAAACTCACCTAATCCCTTACATACCCTCGAATTTTACTCAATCCTCTCTGTACCCCC[A/G]
AATTTTTCACTTTGATTCCTTCCATGCCCCTCCCATTAGGTTTCCGTTTGATCCGTGACTTAATCTGTTTGTTACATTGTCAGTATTTTCAAAAAAAATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.50%	15.50%	0.06%	0.00%	NA
All Indica	2759	98.40%	1.60%	0.00%	0.00%	NA
All Japonica	1512	55.70%	44.20%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	94.80%	5.20%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.80%	0.00%	0.00%	NA
Temperate Japonica	767	28.20%	71.70%	0.13%	0.00%	NA
Tropical Japonica	504	93.70%	6.30%	0.00%	0.00%	NA
Japonica Intermediate	241	63.90%	36.10%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	82.20%	15.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1011002863	T -> C	LOC_Os10g21479.1	downstream_gene_variant ; 191.0bp to feature; MODIFIER	silent_mutation	Average:61.739; most accessible tissue: Minghui63 flower, score: 79.158	N	N	N	N
vg1011002863	T -> C	LOC_Os10g21490.1	downstream_gene_variant ; 4393.0bp to feature; MODIFIER	silent_mutation	Average:61.739; most accessible tissue: Minghui63 flower, score: 79.158	N	N	N	N
vg1011002863	T -> C	LOC_Os10g21470-LOC_Os10g21479	intergenic_region ; MODIFIER	silent_mutation	Average:61.739; most accessible tissue: Minghui63 flower, score: 79.158	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1011002863	NA	2.30E-06	mr1138_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011002863	5.16E-06	NA	mr1166_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011002863	6.11E-07	NA	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011002863	NA	5.07E-08	mr1379_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011002863	3.29E-06	2.17E-08	mr1559_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011002863	4.58E-08	NA	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011002863	NA	9.62E-08	mr1606_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011002863	NA	1.07E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011002863	NA	7.14E-10	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011002863	4.56E-07	2.26E-08	mr1765_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011002863	3.19E-08	7.24E-06	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011002863	NA	1.94E-26	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011002863	NA	1.16E-06	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251