Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010999655:

Variant ID: vg1010999655 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 10999655
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCGGACATTGTCGTCGATGTCAGTGTCGTCAATCAACACGTGCATTAGCTCCACGCCAAAGGGGTCGTCGGCGGCGAGCCCACGCACGCCGGCCACAGC[A/G]
CGGAGCATCCCAGCGATGGCCGCCGCCGCTCAGACCCATCACAGGGACATAACACAAGCGCATTGTCATCGGTGTCGGTGTCGTCAGTCAACACGTCCGT

Reverse complement sequence

ACGGACGTGTTGACTGACGACACCGACACCGATGACAATGCGCTTGTGTTATGTCCCTGTGATGGGTCTGAGCGGCGGCGGCCATCGCTGGGATGCTCCG[T/C]
GCTGTGGCCGGCGTGCGTGGGCTCGCCGCCGACGACCCCTTTGGCGTGGAGCTAATGCACGTGTTGATTGACGACACTGACATCGACGACAATGTCCGGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.70%	18.60%	16.21%	20.44%	NA
All Indica	2759	36.20%	2.20%	27.15%	34.40%	NA
All Japonica	1512	46.40%	52.80%	0.33%	0.53%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	24.50%	6.10%	32.77%	36.64%	NA
Indica II	465	22.20%	1.30%	29.89%	46.67%	NA
Indica III	913	46.80%	0.90%	23.77%	28.59%	NA
Indica Intermediate	786	41.10%	1.50%	25.19%	32.19%	NA
Temperate Japonica	767	11.20%	88.40%	0.26%	0.13%	NA
Tropical Japonica	504	92.30%	6.30%	0.60%	0.79%	NA
Japonica Intermediate	241	62.20%	36.50%	0.00%	1.24%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	55.60%	21.10%	13.33%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1010999655	A -> G	LOC_Os10g21470.1	upstream_gene_variant ; 2270.0bp to feature; MODIFIER	silent_mutation	Average:14.145; most accessible tissue: Callus, score: 29.175	N	N	N	N
vg1010999655	A -> G	LOC_Os10g21470.2	upstream_gene_variant ; 2270.0bp to feature; MODIFIER	silent_mutation	Average:14.145; most accessible tissue: Callus, score: 29.175	N	N	N	N
vg1010999655	A -> G	LOC_Os10g21479.1	downstream_gene_variant ; 3399.0bp to feature; MODIFIER	silent_mutation	Average:14.145; most accessible tissue: Callus, score: 29.175	N	N	N	N
vg1010999655	A -> G	LOC_Os10g21470-LOC_Os10g21479	intergenic_region ; MODIFIER	silent_mutation	Average:14.145; most accessible tissue: Callus, score: 29.175	N	N	N	N
vg1010999655	A -> DEL	N	N	silent_mutation	Average:14.145; most accessible tissue: Callus, score: 29.175	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1010999655	2.44E-06	NA	mr1039	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655	NA	2.04E-22	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655	NA	2.65E-07	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655	NA	4.21E-35	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655	NA	6.58E-09	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655	NA	4.82E-07	mr1555	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655	NA	2.53E-11	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655	NA	2.00E-09	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655	6.77E-07	1.31E-40	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655	NA	3.34E-10	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655	8.92E-06	2.41E-12	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655	NA	1.31E-32	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655	NA	2.69E-10	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655	NA	7.51E-07	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655	NA	1.39E-11	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655	NA	2.83E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655	NA	7.16E-07	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655	NA	5.89E-07	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655	NA	3.03E-06	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655	9.27E-06	7.51E-17	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655	NA	1.65E-07	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251