\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010999655:

Variant ID: vg1010999655 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10999655
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCGGACATTGTCGTCGATGTCAGTGTCGTCAATCAACACGTGCATTAGCTCCACGCCAAAGGGGTCGTCGGCGGCGAGCCCACGCACGCCGGCCACAGC[A/G]
CGGAGCATCCCAGCGATGGCCGCCGCCGCTCAGACCCATCACAGGGACATAACACAAGCGCATTGTCATCGGTGTCGGTGTCGTCAGTCAACACGTCCGT

Reverse complement sequence

ACGGACGTGTTGACTGACGACACCGACACCGATGACAATGCGCTTGTGTTATGTCCCTGTGATGGGTCTGAGCGGCGGCGGCCATCGCTGGGATGCTCCG[T/C]
GCTGTGGCCGGCGTGCGTGGGCTCGCCGCCGACGACCCCTTTGGCGTGGAGCTAATGCACGTGTTGATTGACGACACTGACATCGACGACAATGTCCGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.70% 18.60% 16.21% 20.44% NA
All Indica  2759 36.20% 2.20% 27.15% 34.40% NA
All Japonica  1512 46.40% 52.80% 0.33% 0.53% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 24.50% 6.10% 32.77% 36.64% NA
Indica II  465 22.20% 1.30% 29.89% 46.67% NA
Indica III  913 46.80% 0.90% 23.77% 28.59% NA
Indica Intermediate  786 41.10% 1.50% 25.19% 32.19% NA
Temperate Japonica  767 11.20% 88.40% 0.26% 0.13% NA
Tropical Japonica  504 92.30% 6.30% 0.60% 0.79% NA
Japonica Intermediate  241 62.20% 36.50% 0.00% 1.24% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 55.60% 21.10% 13.33% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010999655 A -> G LOC_Os10g21470.1 upstream_gene_variant ; 2270.0bp to feature; MODIFIER silent_mutation Average:14.145; most accessible tissue: Callus, score: 29.175 N N N N
vg1010999655 A -> G LOC_Os10g21470.2 upstream_gene_variant ; 2270.0bp to feature; MODIFIER silent_mutation Average:14.145; most accessible tissue: Callus, score: 29.175 N N N N
vg1010999655 A -> G LOC_Os10g21479.1 downstream_gene_variant ; 3399.0bp to feature; MODIFIER silent_mutation Average:14.145; most accessible tissue: Callus, score: 29.175 N N N N
vg1010999655 A -> G LOC_Os10g21470-LOC_Os10g21479 intergenic_region ; MODIFIER silent_mutation Average:14.145; most accessible tissue: Callus, score: 29.175 N N N N
vg1010999655 A -> DEL N N silent_mutation Average:14.145; most accessible tissue: Callus, score: 29.175 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010999655 2.44E-06 NA mr1039 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655 NA 2.04E-22 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655 NA 2.65E-07 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655 NA 4.21E-35 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655 NA 6.58E-09 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655 NA 4.82E-07 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655 NA 2.53E-11 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655 NA 2.00E-09 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655 6.77E-07 1.31E-40 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655 NA 3.34E-10 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655 8.92E-06 2.41E-12 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655 NA 1.31E-32 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655 NA 2.69E-10 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655 NA 7.51E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655 NA 1.39E-11 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655 NA 2.83E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655 NA 7.16E-07 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655 NA 5.89E-07 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655 NA 3.03E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655 9.27E-06 7.51E-17 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999655 NA 1.65E-07 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251