\
| Variant ID: vg1010998659 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10998659 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGGATAGCATCTGGTGAAAATTTTTGTAATGTATAGGCATCATCAGAAGTGCTATGAGTGGGACCCATCAAGGTTAATAAAAGAAAGGCAAAATTTGCTA[C/T]
AGGACATCGAAAAAACGTGTAATTAGCTCCTGGACACTCGAGGCCTTATTTTAATATTTCCTATGAACTTGGAGAGAGAAACACTGGTGAGAGTACGATT
AATCGTACTCTCACCAGTGTTTCTCTCTCCAAGTTCATAGGAAATATTAAAATAAGGCCTCGAGTGTCCAGGAGCTAATTACACGTTTTTTCGATGTCCT[G/A]
TAGCAAATTTTGCCTTTCTTTTATTAACCTTGATGGGTCCCACTCATAGCACTTCTGATGATGCCTATACATTACAAAAATTTTCACCAGATGCTATCCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.60% | 10.00% | 0.15% | 40.27% | NA |
| All Indica | 2759 | 28.10% | 3.90% | 0.18% | 67.81% | NA |
| All Japonica | 1512 | 98.50% | 0.70% | 0.07% | 0.73% | NA |
| Aus | 269 | 2.60% | 97.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 24.00% | 2.50% | 0.50% | 72.94% | NA |
| Indica II | 465 | 14.60% | 1.10% | 0.22% | 84.09% | NA |
| Indica III | 913 | 37.00% | 3.10% | 0.00% | 59.91% | NA |
| Indica Intermediate | 786 | 28.80% | 7.60% | 0.13% | 63.49% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 98.20% | 0.40% | 0.20% | 1.19% | NA |
| Japonica Intermediate | 241 | 95.40% | 3.30% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 17.70% | 81.20% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 58.90% | 18.90% | 1.11% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010998659 | C -> T | LOC_Os10g21470.1 | upstream_gene_variant ; 1274.0bp to feature; MODIFIER | silent_mutation | Average:12.973; most accessible tissue: Callus, score: 37.163 | N | N | N | N |
| vg1010998659 | C -> T | LOC_Os10g21470.2 | upstream_gene_variant ; 1274.0bp to feature; MODIFIER | silent_mutation | Average:12.973; most accessible tissue: Callus, score: 37.163 | N | N | N | N |
| vg1010998659 | C -> T | LOC_Os10g21479.1 | downstream_gene_variant ; 4395.0bp to feature; MODIFIER | silent_mutation | Average:12.973; most accessible tissue: Callus, score: 37.163 | N | N | N | N |
| vg1010998659 | C -> T | LOC_Os10g21470-LOC_Os10g21479 | intergenic_region ; MODIFIER | silent_mutation | Average:12.973; most accessible tissue: Callus, score: 37.163 | N | N | N | N |
| vg1010998659 | C -> DEL | N | N | silent_mutation | Average:12.973; most accessible tissue: Callus, score: 37.163 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010998659 | NA | 5.21E-22 | mr1095 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010998659 | NA | 2.79E-25 | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010998659 | NA | 1.38E-13 | mr1231 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010998659 | 1.67E-06 | NA | mr1246 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010998659 | NA | 8.91E-30 | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010998659 | NA | 1.83E-11 | mr1409 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010998659 | NA | 6.75E-14 | mr1522 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010998659 | NA | 9.71E-11 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010998659 | NA | 1.33E-28 | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010998659 | NA | 1.26E-19 | mr1765 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010998659 | NA | 1.48E-18 | mr1911 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010998659 | NA | 7.55E-23 | mr1961 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010998659 | NA | 1.57E-20 | mr1095_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010998659 | NA | 1.77E-07 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010998659 | NA | 3.70E-09 | mr1166_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010998659 | NA | 3.87E-26 | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010998659 | NA | 1.15E-11 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010998659 | NA | 7.64E-07 | mr1522_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010998659 | NA | 9.25E-14 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010998659 | NA | 1.65E-08 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010998659 | NA | 4.21E-09 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010998659 | NA | 1.09E-12 | mr1803_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010998659 | NA | 1.91E-15 | mr1911_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010998659 | NA | 1.09E-09 | mr1942_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |