\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010974418:

Variant ID: vg1010974418 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10974418
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTTTGTGAGTCGCACCCATGGCAATTAAGGACCGGTTCACGGGAAACCCTGGAAGACTTACAACGCTTGCCACAAGCGGGAGTGGGTAACTTCTTGAAC[A/T]
GAAGTATAGCTCGACCCTTTCCTAGGCACCGGTGGCGAGGGTGGGCGTGATGGAGTTGGGTCGGCCGGGGTGTCCGGTTGTCCAGCTGCCGGATTCACCG

Reverse complement sequence

CGGTGAATCCGGCAGCTGGACAACCGGACACCCCGGCCGACCCAACTCCATCACGCCCACCCTCGCCACCGGTGCCTAGGAAAGGGTCGAGCTATACTTC[T/A]
GTTCAAGAAGTTACCCACTCCCGCTTGTGGCAAGCGTTGTAAGTCTTCCAGGGTTTCCCGTGAACCGGTCCTTAATTGCCATGGGTGCGACTCACAAAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 19.10% 1.90% 26.01% 52.90% NA
All Indica  2759 2.80% 0.10% 26.42% 70.61% NA
All Japonica  1512 53.10% 5.50% 13.49% 27.91% NA
Aus  269 0.40% 0.00% 82.16% 17.47% NA
Indica I  595 7.20% 0.20% 14.29% 78.32% NA
Indica II  465 2.60% 0.00% 11.61% 85.81% NA
Indica III  913 1.00% 0.10% 39.98% 58.93% NA
Indica Intermediate  786 1.80% 0.30% 28.63% 69.34% NA
Temperate Japonica  767 88.80% 2.10% 1.56% 7.56% NA
Tropical Japonica  504 6.90% 3.80% 31.75% 57.54% NA
Japonica Intermediate  241 36.10% 19.90% 13.28% 30.71% NA
VI/Aromatic  96 2.10% 0.00% 48.96% 48.96% NA
Intermediate  90 23.30% 5.60% 31.11% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010974418 A -> T LOC_Os10g21420.1 downstream_gene_variant ; 3713.0bp to feature; MODIFIER silent_mutation Average:19.032; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1010974418 A -> T LOC_Os10g21430.1 downstream_gene_variant ; 469.0bp to feature; MODIFIER silent_mutation Average:19.032; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1010974418 A -> T LOC_Os10g21420-LOC_Os10g21430 intergenic_region ; MODIFIER silent_mutation Average:19.032; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1010974418 A -> DEL N N silent_mutation Average:19.032; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010974418 1.34E-08 1.36E-27 mr1300 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974418 NA 2.10E-08 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974418 9.51E-08 1.30E-40 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974418 NA 5.72E-10 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974418 NA 3.05E-11 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974418 NA 2.07E-09 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974418 2.75E-10 3.94E-48 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974418 9.99E-06 1.70E-11 mr1926 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974418 3.21E-06 6.02E-13 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974418 NA 5.11E-06 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974418 1.60E-08 5.73E-40 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974418 NA 1.18E-11 mr1310_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974418 NA 2.46E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974418 NA 1.19E-08 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974418 NA 2.27E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974418 NA 5.78E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974418 1.40E-07 1.02E-19 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974418 NA 2.99E-08 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251