\
| Variant ID: vg1010974062 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10974062 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 222. )
CCCTTGAGCATGTTGTTCCCAATTTATAAATGTTTTACCATTTGCAAATAAATATGCATGTTTTGCTAATTACATGGGATCAGGGTTTACCTATCTGCTC[G/A]
CTTGCGCCATGTTTACTTGATATCTGTCCTTTGTCAACCGTGGGTAATAAATCGCCTAGCTTGTGTTACTTTGATGACCTAGCTAGAACTATATGCTTAG
CTAAGCATATAGTTCTAGCTAGGTCATCAAAGTAACACAAGCTAGGCGATTTATTACCCACGGTTGACAAAGGACAGATATCAAGTAAACATGGCGCAAG[C/T]
GAGCAGATAGGTAAACCCTGATCCCATGTAATTAGCAAAACATGCATATTTATTTGCAAATGGTAAAACATTTATAAATTGGGAACAACATGCTCAAGGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.50% | 2.80% | 5.12% | 18.60% | NA |
| All Indica | 2759 | 81.90% | 0.00% | 6.09% | 12.00% | NA |
| All Japonica | 1512 | 58.10% | 8.30% | 4.56% | 29.03% | NA |
| Aus | 269 | 82.90% | 0.00% | 0.74% | 16.36% | NA |
| Indica I | 595 | 76.60% | 0.00% | 12.10% | 11.26% | NA |
| Indica II | 465 | 69.70% | 0.00% | 9.03% | 21.29% | NA |
| Indica III | 913 | 91.30% | 0.10% | 1.53% | 7.01% | NA |
| Indica Intermediate | 786 | 82.10% | 0.00% | 5.09% | 12.85% | NA |
| Temperate Japonica | 767 | 75.10% | 16.30% | 0.65% | 7.95% | NA |
| Tropical Japonica | 504 | 31.00% | 0.00% | 10.71% | 58.33% | NA |
| Japonica Intermediate | 241 | 60.60% | 0.40% | 4.15% | 34.85% | NA |
| VI/Aromatic | 96 | 44.80% | 3.10% | 3.12% | 48.96% | NA |
| Intermediate | 90 | 77.80% | 2.20% | 0.00% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010974062 | G -> A | LOC_Os10g21420.1 | downstream_gene_variant ; 3357.0bp to feature; MODIFIER | silent_mutation | Average:13.083; most accessible tissue: Callus, score: 22.096 | N | N | N | N |
| vg1010974062 | G -> A | LOC_Os10g21430.1 | downstream_gene_variant ; 825.0bp to feature; MODIFIER | silent_mutation | Average:13.083; most accessible tissue: Callus, score: 22.096 | N | N | N | N |
| vg1010974062 | G -> A | LOC_Os10g21420-LOC_Os10g21430 | intergenic_region ; MODIFIER | silent_mutation | Average:13.083; most accessible tissue: Callus, score: 22.096 | N | N | N | N |
| vg1010974062 | G -> DEL | N | N | silent_mutation | Average:13.083; most accessible tissue: Callus, score: 22.096 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010974062 | NA | 1.83E-08 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010974062 | NA | 2.07E-08 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010974062 | NA | 9.40E-10 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010974062 | NA | 3.06E-08 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010974062 | 1.70E-06 | 1.70E-06 | mr1166_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010974062 | 6.34E-06 | 1.04E-09 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010974062 | NA | 2.00E-07 | mr1409_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010974062 | 3.33E-08 | 5.45E-09 | mr1559_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010974062 | 8.31E-07 | 2.22E-14 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010974062 | 7.78E-06 | 1.88E-07 | mr1703_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010974062 | 3.10E-06 | 3.89E-09 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010974062 | NA | 4.82E-06 | mr1793_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |