Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010974062:

Variant ID: vg1010974062 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 10974062
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

CCCTTGAGCATGTTGTTCCCAATTTATAAATGTTTTACCATTTGCAAATAAATATGCATGTTTTGCTAATTACATGGGATCAGGGTTTACCTATCTGCTC[G/A]
CTTGCGCCATGTTTACTTGATATCTGTCCTTTGTCAACCGTGGGTAATAAATCGCCTAGCTTGTGTTACTTTGATGACCTAGCTAGAACTATATGCTTAG

Reverse complement sequence

CTAAGCATATAGTTCTAGCTAGGTCATCAAAGTAACACAAGCTAGGCGATTTATTACCCACGGTTGACAAAGGACAGATATCAAGTAAACATGGCGCAAG[C/T]
GAGCAGATAGGTAAACCCTGATCCCATGTAATTAGCAAAACATGCATATTTATTTGCAAATGGTAAAACATTTATAAATTGGGAACAACATGCTCAAGGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.50%	2.80%	5.12%	18.60%	NA
All Indica	2759	81.90%	0.00%	6.09%	12.00%	NA
All Japonica	1512	58.10%	8.30%	4.56%	29.03%	NA
Aus	269	82.90%	0.00%	0.74%	16.36%	NA
Indica I	595	76.60%	0.00%	12.10%	11.26%	NA
Indica II	465	69.70%	0.00%	9.03%	21.29%	NA
Indica III	913	91.30%	0.10%	1.53%	7.01%	NA
Indica Intermediate	786	82.10%	0.00%	5.09%	12.85%	NA
Temperate Japonica	767	75.10%	16.30%	0.65%	7.95%	NA
Tropical Japonica	504	31.00%	0.00%	10.71%	58.33%	NA
Japonica Intermediate	241	60.60%	0.40%	4.15%	34.85%	NA
VI/Aromatic	96	44.80%	3.10%	3.12%	48.96%	NA
Intermediate	90	77.80%	2.20%	0.00%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1010974062	G -> A	LOC_Os10g21420.1	downstream_gene_variant ; 3357.0bp to feature; MODIFIER	silent_mutation	Average:13.083; most accessible tissue: Callus, score: 22.096	N	N	N	N
vg1010974062	G -> A	LOC_Os10g21430.1	downstream_gene_variant ; 825.0bp to feature; MODIFIER	silent_mutation	Average:13.083; most accessible tissue: Callus, score: 22.096	N	N	N	N
vg1010974062	G -> A	LOC_Os10g21420-LOC_Os10g21430	intergenic_region ; MODIFIER	silent_mutation	Average:13.083; most accessible tissue: Callus, score: 22.096	N	N	N	N
vg1010974062	G -> DEL	N	N	silent_mutation	Average:13.083; most accessible tissue: Callus, score: 22.096	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1010974062	NA	1.83E-08	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974062	NA	2.07E-08	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974062	NA	9.40E-10	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974062	NA	3.06E-08	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974062	1.70E-06	1.70E-06	mr1166_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974062	6.34E-06	1.04E-09	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974062	NA	2.00E-07	mr1409_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974062	3.33E-08	5.45E-09	mr1559_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974062	8.31E-07	2.22E-14	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974062	7.78E-06	1.88E-07	mr1703_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974062	3.10E-06	3.89E-09	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010974062	NA	4.82E-06	mr1793_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251