\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010774180:

Variant ID: vg1010774180 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10774180
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


TCAAAAGAAATGTTTCCGCCTTTTTATCAAGCAAGTCCAACCTATCTAAAATCTCCTTTCTTTTTTTTTGTGCAAACCACTTGTATGTTTAGCCCAACCC[T/C]
TGAGATGTTGTCTAAATCGACGAATTTTCGCCTGCCAACGTTCCATAGGAGAATTTCCTTCATCAACACTAGAACAAACTTCCTTCACCATATCAACAAA

Reverse complement sequence

TTTGTTGATATGGTGAAGGAAGTTTGTTCTAGTGTTGATGAAGGAAATTCTCCTATGGAACGTTGGCAGGCGAAAATTCGTCGATTTAGACAACATCTCA[A/G]
GGGTTGGGCTAAACATACAAGTGGTTTGCACAAAAAAAAAGAAAGGAGATTTTAGATAGGTTGGACTTGCTTGATAAAAAGGCGGAAACATTTCTTTTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.00% 5.30% 0.15% 4.51% NA
All Indica  2759 96.00% 0.30% 0.00% 3.66% NA
All Japonica  1512 76.80% 15.70% 0.20% 7.28% NA
Aus  269 98.90% 0.00% 1.12% 0.00% NA
Indica I  595 90.10% 0.20% 0.00% 9.75% NA
Indica II  465 98.90% 0.40% 0.00% 0.65% NA
Indica III  913 98.70% 0.00% 0.00% 1.31% NA
Indica Intermediate  786 95.70% 0.80% 0.00% 3.56% NA
Temperate Japonica  767 57.20% 28.30% 0.26% 14.21% NA
Tropical Japonica  504 96.60% 3.40% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 1.70% 0.41% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 4.40% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010774180 T -> C LOC_Os10g21150.1 downstream_gene_variant ; 2954.0bp to feature; MODIFIER silent_mutation Average:33.747; most accessible tissue: Zhenshan97 young leaf, score: 60.8 N N N N
vg1010774180 T -> C LOC_Os10g21150-LOC_Os10g21160 intergenic_region ; MODIFIER silent_mutation Average:33.747; most accessible tissue: Zhenshan97 young leaf, score: 60.8 N N N N
vg1010774180 T -> DEL N N silent_mutation Average:33.747; most accessible tissue: Zhenshan97 young leaf, score: 60.8 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010774180 NA 2.97E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010774180 2.01E-06 1.90E-09 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010774180 7.80E-07 6.09E-08 mr1647_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010774180 6.96E-06 6.96E-06 mr1647_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010774180 NA 7.58E-09 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251