\
| Variant ID: vg1010744278 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10744278 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 30. )
GACATCGAATATGGAAGTGCATGCCGAGATGTCGAAGCTCTTGTAGACGTCGTGGTTGGTGAAGTAGCAAAACTTGCGAAGTAGCGGCAATTAGGTTTGC[C/T]
GGTGCCGAAGATAATATAGATGAAGTCGCTTCACCATGGTGACAAAGTTGCATAGCTGTGATGAAGTGAACACGAGTCGGCGGCAACAGAAGCAAACCGG
CCGGTTTGCTTCTGTTGCCGCCGACTCGTGTTCACTTCATCACAGCTATGCAACTTTGTCACCATGGTGAAGCGACTTCATCTATATTATCTTCGGCACC[G/A]
GCAAACCTAATTGCCGCTACTTCGCAAGTTTTGCTACTTCACCAACCACGACGTCTACAAGAGCTTCGACATCTCGGCATGCACTTCCATATTCGATGTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.40% | 2.70% | 7.74% | 52.14% | NA |
| All Indica | 2759 | 17.00% | 4.50% | 11.45% | 67.05% | NA |
| All Japonica | 1512 | 78.70% | 0.10% | 0.79% | 20.37% | NA |
| Aus | 269 | 5.20% | 0.00% | 6.69% | 88.10% | NA |
| Indica I | 595 | 12.30% | 6.90% | 18.66% | 62.18% | NA |
| Indica II | 465 | 5.40% | 3.70% | 8.82% | 82.15% | NA |
| Indica III | 913 | 27.80% | 2.60% | 7.78% | 61.77% | NA |
| Indica Intermediate | 786 | 14.80% | 5.50% | 11.83% | 67.94% | NA |
| Temperate Japonica | 767 | 74.30% | 0.00% | 0.91% | 24.77% | NA |
| Tropical Japonica | 504 | 94.20% | 0.00% | 0.00% | 5.75% | NA |
| Japonica Intermediate | 241 | 60.20% | 0.80% | 2.07% | 36.93% | NA |
| VI/Aromatic | 96 | 58.30% | 0.00% | 14.58% | 27.08% | NA |
| Intermediate | 90 | 44.40% | 1.10% | 6.67% | 47.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010744278 | C -> T | LOC_Os10g21130.1 | downstream_gene_variant ; 4615.0bp to feature; MODIFIER | silent_mutation | Average:10.988; most accessible tissue: Minghui63 young leaf, score: 16.99 | N | N | N | N |
| vg1010744278 | C -> T | LOC_Os10g21110-LOC_Os10g21130 | intergenic_region ; MODIFIER | silent_mutation | Average:10.988; most accessible tissue: Minghui63 young leaf, score: 16.99 | N | N | N | N |
| vg1010744278 | C -> DEL | N | N | silent_mutation | Average:10.988; most accessible tissue: Minghui63 young leaf, score: 16.99 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010744278 | NA | 6.13E-09 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010744278 | 1.37E-06 | NA | mr1502 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010744278 | 4.14E-07 | NA | mr1502 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010744278 | 3.00E-06 | NA | mr1519 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010744278 | 4.48E-09 | NA | mr1798 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010744278 | 1.62E-07 | 6.66E-10 | mr1798 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010744278 | 8.23E-06 | NA | mr1913 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |