\
| Variant ID: vg1010732405 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10732405 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATTGGAATCATTGTCGGATTGAGTTGACGTGATTGCCACGTACAGATCGAGTCCGAAGAAGGCAGTTGTATCTATTAATTAGGAATAGTTTGTTAGTTTT[C/T]
TTTTTATCTTTAGGAAAGTGTGTTTAGTGTCCTATAAGGACTTTATGTTTTCCTTTTTTTTAGGAAAGTTTCTTTCTCGTCCTACAAGGACTAGTATCTA
TAGATACTAGTCCTTGTAGGACGAGAAAGAAACTTTCCTAAAAAAAAGGAAAACATAAAGTCCTTATAGGACACTAAACACACTTTCCTAAAGATAAAAA[G/A]
AAAACTAACAAACTATTCCTAATTAATAGATACAACTGCCTTCTTCGGACTCGATCTGTACGTGGCAATCACGTCAACTCAATCCGACAATGATTCCAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.20% | 11.20% | 0.63% | 0.95% | NA |
| All Indica | 2759 | 98.30% | 1.40% | 0.07% | 0.22% | NA |
| All Japonica | 1512 | 65.00% | 30.80% | 1.72% | 2.51% | NA |
| Aus | 269 | 97.80% | 1.90% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.20% | 3.20% | 0.11% | 0.55% | NA |
| Indica Intermediate | 786 | 98.50% | 1.30% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 91.70% | 7.40% | 0.26% | 0.65% | NA |
| Tropical Japonica | 504 | 24.40% | 67.50% | 2.98% | 5.16% | NA |
| Japonica Intermediate | 241 | 65.10% | 28.20% | 3.73% | 2.90% | NA |
| VI/Aromatic | 96 | 90.60% | 7.30% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010732405 | C -> T | LOC_Os10g21110.1 | downstream_gene_variant ; 1476.0bp to feature; MODIFIER | silent_mutation | Average:31.854; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg1010732405 | C -> T | LOC_Os10g21110-LOC_Os10g21130 | intergenic_region ; MODIFIER | silent_mutation | Average:31.854; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg1010732405 | C -> DEL | N | N | silent_mutation | Average:31.854; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010732405 | NA | 3.51E-10 | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010732405 | NA | 3.80E-10 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010732405 | NA | 4.07E-11 | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010732405 | NA | 2.05E-10 | mr1178 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010732405 | NA | 1.53E-07 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010732405 | NA | 4.48E-20 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010732405 | NA | 5.65E-12 | mr1580 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010732405 | NA | 1.13E-19 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010732405 | NA | 2.63E-10 | mr1825 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010732405 | NA | 2.00E-07 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010732405 | NA | 2.12E-12 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010732405 | NA | 3.76E-15 | mr1178_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010732405 | NA | 1.17E-07 | mr1261_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010732405 | NA | 6.54E-09 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010732405 | NA | 9.06E-13 | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010732405 | NA | 4.21E-09 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |