\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010732405:

Variant ID: vg1010732405 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10732405
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTGGAATCATTGTCGGATTGAGTTGACGTGATTGCCACGTACAGATCGAGTCCGAAGAAGGCAGTTGTATCTATTAATTAGGAATAGTTTGTTAGTTTT[C/T]
TTTTTATCTTTAGGAAAGTGTGTTTAGTGTCCTATAAGGACTTTATGTTTTCCTTTTTTTTAGGAAAGTTTCTTTCTCGTCCTACAAGGACTAGTATCTA

Reverse complement sequence

TAGATACTAGTCCTTGTAGGACGAGAAAGAAACTTTCCTAAAAAAAAGGAAAACATAAAGTCCTTATAGGACACTAAACACACTTTCCTAAAGATAAAAA[G/A]
AAAACTAACAAACTATTCCTAATTAATAGATACAACTGCCTTCTTCGGACTCGATCTGTACGTGGCAATCACGTCAACTCAATCCGACAATGATTCCAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.20% 11.20% 0.63% 0.95% NA
All Indica  2759 98.30% 1.40% 0.07% 0.22% NA
All Japonica  1512 65.00% 30.80% 1.72% 2.51% NA
Aus  269 97.80% 1.90% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 96.20% 3.20% 0.11% 0.55% NA
Indica Intermediate  786 98.50% 1.30% 0.13% 0.13% NA
Temperate Japonica  767 91.70% 7.40% 0.26% 0.65% NA
Tropical Japonica  504 24.40% 67.50% 2.98% 5.16% NA
Japonica Intermediate  241 65.10% 28.20% 3.73% 2.90% NA
VI/Aromatic  96 90.60% 7.30% 1.04% 1.04% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010732405 C -> T LOC_Os10g21110.1 downstream_gene_variant ; 1476.0bp to feature; MODIFIER silent_mutation Average:31.854; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg1010732405 C -> T LOC_Os10g21110-LOC_Os10g21130 intergenic_region ; MODIFIER silent_mutation Average:31.854; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg1010732405 C -> DEL N N silent_mutation Average:31.854; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010732405 NA 3.51E-10 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010732405 NA 3.80E-10 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010732405 NA 4.07E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010732405 NA 2.05E-10 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010732405 NA 1.53E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010732405 NA 4.48E-20 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010732405 NA 5.65E-12 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010732405 NA 1.13E-19 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010732405 NA 2.63E-10 mr1825 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010732405 NA 2.00E-07 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010732405 NA 2.12E-12 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010732405 NA 3.76E-15 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010732405 NA 1.17E-07 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010732405 NA 6.54E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010732405 NA 9.06E-13 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010732405 NA 4.21E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251