\
| Variant ID: vg1010719593 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10719593 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCCTATGCCTTTTAAACCTGTGGAACCATCATTTCTTATCATTATATCTATCTTATATAGAAAACAAGCGTGTATTCATGCTATAGTAATATGAATACTA[T/C]
AACATTTCAAAACTAATACTGCACAATTATATTTTGTCATTATAGTATTCACGTTAAGCTGTGTGGAGGCTTTGACCTACTCTAAATGAAATGTTTTTAG
CTAAAAACATTTCATTTAGAGTAGGTCAAAGCCTCCACACAGCTTAACGTGAATACTATAATGACAAAATATAATTGTGCAGTATTAGTTTTGAAATGTT[A/G]
TAGTATTCATATTACTATAGCATGAATACACGCTTGTTTTCTATATAAGATAGATATAATGATAAGAAATGATGGTTCCACAGGTTTAAAAGGCATAGGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.70% | 8.30% | 10.18% | 53.79% | NA |
| All Indica | 2759 | 19.90% | 7.10% | 14.82% | 58.14% | NA |
| All Japonica | 1512 | 44.60% | 8.90% | 2.18% | 44.31% | NA |
| Aus | 269 | 15.60% | 5.90% | 10.04% | 68.40% | NA |
| Indica I | 595 | 10.10% | 1.70% | 21.51% | 66.72% | NA |
| Indica II | 465 | 20.90% | 0.60% | 16.77% | 61.72% | NA |
| Indica III | 913 | 21.10% | 12.90% | 9.53% | 56.41% | NA |
| Indica Intermediate | 786 | 25.30% | 8.40% | 14.76% | 51.53% | NA |
| Temperate Japonica | 767 | 64.90% | 1.20% | 0.78% | 33.12% | NA |
| Tropical Japonica | 504 | 22.60% | 16.10% | 2.58% | 58.73% | NA |
| Japonica Intermediate | 241 | 26.10% | 18.30% | 5.81% | 49.79% | NA |
| VI/Aromatic | 96 | 6.20% | 44.80% | 4.17% | 44.79% | NA |
| Intermediate | 90 | 41.10% | 4.40% | 8.89% | 45.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010719593 | T -> C | LOC_Os10g21100.1 | downstream_gene_variant ; 4052.0bp to feature; MODIFIER | silent_mutation | Average:11.181; most accessible tissue: Callus, score: 31.79 | N | N | N | N |
| vg1010719593 | T -> C | LOC_Os10g21100-LOC_Os10g21110 | intergenic_region ; MODIFIER | silent_mutation | Average:11.181; most accessible tissue: Callus, score: 31.79 | N | N | N | N |
| vg1010719593 | T -> DEL | N | N | silent_mutation | Average:11.181; most accessible tissue: Callus, score: 31.79 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010719593 | NA | 5.01E-06 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010719593 | 1.73E-07 | NA | mr1798 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010719593 | NA | 3.07E-08 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010719593 | 1.23E-07 | 9.64E-09 | mr1037_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010719593 | 5.78E-16 | NA | mr1798_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010719593 | 4.47E-07 | 7.32E-15 | mr1798_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010719593 | 3.95E-08 | NA | mr1798_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |