\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010719593:

Variant ID: vg1010719593 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10719593
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCTATGCCTTTTAAACCTGTGGAACCATCATTTCTTATCATTATATCTATCTTATATAGAAAACAAGCGTGTATTCATGCTATAGTAATATGAATACTA[T/C]
AACATTTCAAAACTAATACTGCACAATTATATTTTGTCATTATAGTATTCACGTTAAGCTGTGTGGAGGCTTTGACCTACTCTAAATGAAATGTTTTTAG

Reverse complement sequence

CTAAAAACATTTCATTTAGAGTAGGTCAAAGCCTCCACACAGCTTAACGTGAATACTATAATGACAAAATATAATTGTGCAGTATTAGTTTTGAAATGTT[A/G]
TAGTATTCATATTACTATAGCATGAATACACGCTTGTTTTCTATATAAGATAGATATAATGATAAGAAATGATGGTTCCACAGGTTTAAAAGGCATAGGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.70% 8.30% 10.18% 53.79% NA
All Indica  2759 19.90% 7.10% 14.82% 58.14% NA
All Japonica  1512 44.60% 8.90% 2.18% 44.31% NA
Aus  269 15.60% 5.90% 10.04% 68.40% NA
Indica I  595 10.10% 1.70% 21.51% 66.72% NA
Indica II  465 20.90% 0.60% 16.77% 61.72% NA
Indica III  913 21.10% 12.90% 9.53% 56.41% NA
Indica Intermediate  786 25.30% 8.40% 14.76% 51.53% NA
Temperate Japonica  767 64.90% 1.20% 0.78% 33.12% NA
Tropical Japonica  504 22.60% 16.10% 2.58% 58.73% NA
Japonica Intermediate  241 26.10% 18.30% 5.81% 49.79% NA
VI/Aromatic  96 6.20% 44.80% 4.17% 44.79% NA
Intermediate  90 41.10% 4.40% 8.89% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010719593 T -> C LOC_Os10g21100.1 downstream_gene_variant ; 4052.0bp to feature; MODIFIER silent_mutation Average:11.181; most accessible tissue: Callus, score: 31.79 N N N N
vg1010719593 T -> C LOC_Os10g21100-LOC_Os10g21110 intergenic_region ; MODIFIER silent_mutation Average:11.181; most accessible tissue: Callus, score: 31.79 N N N N
vg1010719593 T -> DEL N N silent_mutation Average:11.181; most accessible tissue: Callus, score: 31.79 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010719593 NA 5.01E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010719593 1.73E-07 NA mr1798 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010719593 NA 3.07E-08 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010719593 1.23E-07 9.64E-09 mr1037_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010719593 5.78E-16 NA mr1798_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010719593 4.47E-07 7.32E-15 mr1798_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010719593 3.95E-08 NA mr1798_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251