\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010713156:

Variant ID: vg1010713156 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10713156
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAACTCTTGGAGCTAAATTTAGGAGTTAGAGCTGTACCAAACAGGCCCTAAATACTCCCTCTATTCTAAAATATAAGAATTTGTATATGATTTACAAAAT[A/G]
TATTAGACATCATATGAATAGATACATCTTGAAAAGCGTAAAAAATCATTATAGCTTGAAACAGAGAAGATATAACCAAGCATATTCCAAAATTAGACGG

Reverse complement sequence

CCGTCTAATTTTGGAATATGCTTGGTTATATCTTCTCTGTTTCAAGCTATAATGATTTTTTACGCTTTTCAAGATGTATCTATTCATATGATGTCTAATA[T/C]
ATTTTGTAAATCATATACAAATTCTTATATTTTAGAATAGAGGGAGTATTTAGGGCCTGTTTGGTACAGCTCTAACTCCTAAATTTAGCTCCAAGAGTTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.60% 8.00% 0.23% 8.15% NA
All Indica  2759 96.40% 0.70% 0.07% 2.83% NA
All Japonica  1512 79.00% 20.00% 0.00% 0.93% NA
Aus  269 3.70% 13.40% 1.86% 81.04% NA
Indica I  595 98.00% 0.50% 0.00% 1.51% NA
Indica II  465 98.90% 0.20% 0.22% 0.65% NA
Indica III  913 96.90% 0.70% 0.00% 2.41% NA
Indica Intermediate  786 93.00% 1.30% 0.13% 5.60% NA
Temperate Japonica  767 74.10% 25.90% 0.00% 0.00% NA
Tropical Japonica  504 94.80% 3.80% 0.00% 1.39% NA
Japonica Intermediate  241 61.80% 35.30% 0.00% 2.90% NA
VI/Aromatic  96 20.80% 11.50% 2.08% 65.62% NA
Intermediate  90 76.70% 7.80% 2.22% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010713156 A -> G LOC_Os10g21100.1 intron_variant ; MODIFIER silent_mutation Average:49.151; most accessible tissue: Zhenshan97 panicle, score: 80.486 N N N N
vg1010713156 A -> DEL N N silent_mutation Average:49.151; most accessible tissue: Zhenshan97 panicle, score: 80.486 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010713156 1.10E-07 6.00E-26 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010713156 1.32E-07 2.25E-29 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010713156 NA 4.53E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010713156 NA 1.49E-16 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010713156 1.29E-06 1.77E-16 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010713156 NA 3.06E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010713156 2.11E-09 2.61E-33 mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010713156 NA 5.23E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010713156 NA 7.52E-08 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010713156 NA 1.12E-20 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010713156 NA 7.42E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010713156 NA 2.33E-10 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010713156 NA 8.63E-17 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010713156 2.00E-09 2.47E-26 mr1305_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010713156 NA 2.26E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010713156 NA 2.02E-08 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010713156 9.36E-06 9.36E-06 mr1360_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010713156 4.06E-06 2.92E-18 mr1409_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010713156 4.52E-07 1.03E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010713156 1.43E-10 8.57E-17 mr1585_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010713156 6.33E-06 2.75E-09 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010713156 NA 2.44E-11 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010713156 NA 4.23E-09 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010713156 2.24E-07 4.89E-10 mr1765_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010713156 NA 2.32E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251