\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010661385:

Variant ID: vg1010661385 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10661385
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.08, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTAGCGTTGGACAGTCATGAGGTTAATACTACTAAATTATATTCTGCTTTACTGTTTTTAACTTATGATTTATAAATGCTACTTTTACTGCAAATATC[C/T]
TATGAGCCATTCCTTCGATATCCTTGCATCATACCTTCTCATTGGTATGACTTGTTGAGTACAGTGGTTGTACTCAATCTTGCTTTATTTTCCCAATCCC

Reverse complement sequence

GGGATTGGGAAAATAAAGCAAGATTGAGTACAACCACTGTACTCAACAAGTCATACCAATGAGAAGGTATGATGCAAGGATATCGAAGGAATGGCTCATA[G/A]
GATATTTGCAGTAAAAGTAGCATTTATAAATCATAAGTTAAAAACAGTAAAGCAGAATATAATTTAGTAGTATTAACCTCATGACTGTCCAACGCTAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.10% 13.90% 0.00% 0.00% NA
All Indica  2759 89.80% 10.20% 0.00% 0.00% NA
All Japonica  1512 98.90% 1.10% 0.00% 0.00% NA
Aus  269 2.60% 97.40% 0.00% 0.00% NA
Indica I  595 96.80% 3.20% 0.00% 0.00% NA
Indica II  465 91.80% 8.20% 0.00% 0.00% NA
Indica III  913 88.20% 11.80% 0.00% 0.00% NA
Indica Intermediate  786 85.20% 14.80% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 96.30% 3.70% 0.00% 0.00% NA
VI/Aromatic  96 17.70% 82.30% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010661385 C -> T LOC_Os10g21040.1 downstream_gene_variant ; 1195.0bp to feature; MODIFIER silent_mutation Average:44.84; most accessible tissue: Zhenshan97 young leaf, score: 55.899 N N N N
vg1010661385 C -> T LOC_Os10g21050.1 downstream_gene_variant ; 1040.0bp to feature; MODIFIER silent_mutation Average:44.84; most accessible tissue: Zhenshan97 young leaf, score: 55.899 N N N N
vg1010661385 C -> T LOC_Os10g21060.1 downstream_gene_variant ; 3345.0bp to feature; MODIFIER silent_mutation Average:44.84; most accessible tissue: Zhenshan97 young leaf, score: 55.899 N N N N
vg1010661385 C -> T LOC_Os10g21040-LOC_Os10g21050 intergenic_region ; MODIFIER silent_mutation Average:44.84; most accessible tissue: Zhenshan97 young leaf, score: 55.899 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010661385 NA 6.18E-07 Awn_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1010661385 4.05E-07 NA mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010661385 3.08E-06 4.90E-13 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010661385 1.68E-06 NA mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010661385 8.78E-06 1.87E-12 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010661385 4.28E-06 NA mr1261 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010661385 2.54E-07 8.57E-10 mr1261 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010661385 NA 1.81E-23 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010661385 NA 3.26E-13 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010661385 NA 1.14E-06 mr1729 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010661385 NA 1.27E-10 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010661385 NA 1.60E-21 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010661385 NA 2.10E-07 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010661385 NA 1.55E-07 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010661385 NA 2.44E-18 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251