Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010652163:

Variant ID: vg1010652163 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 10652163
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, A: 0.09, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

CATCTGTGATTTCTAAATTGTGTTTACGCATCATTTTGACTCTCGAAATCAGCATTATTTGTTTTTACCTTTTTCTTTATAATCAATACATGATTCGTTC[T/A]
CCTTTTTTGTGCTAATTATCTGGTAGTTTGTTACTGCTCCCTGAAAGTTTCCACGTTTGTGCTACCTTAGTGAACAAGGATGGAATTCGCAATTGGTTTG

Reverse complement sequence

CAAACCAATTGCGAATTCCATCCTTGTTCACTAAGGTAGCACAAACGTGGAAACTTTCAGGGAGCAGTAACAAACTACCAGATAATTAGCACAAAAAAGG[A/T]
GAACGAATCATGTATTGATTATAAAGAAAAAGGTAAAAACAAATAATGCTGATTTCGAGAGTCAAAATGATGCGTAAACACAATTTAGAAATCACAGATG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.40%	43.60%	0.04%	0.00%	NA
All Indica	2759	39.90%	60.10%	0.04%	0.00%	NA
All Japonica	1512	98.30%	1.60%	0.07%	0.00%	NA
Aus	269	2.60%	97.40%	0.00%	0.00%	NA
Indica I	595	24.50%	75.50%	0.00%	0.00%	NA
Indica II	465	29.50%	70.50%	0.00%	0.00%	NA
Indica III	913	54.90%	45.10%	0.00%	0.00%	NA
Indica Intermediate	786	40.30%	59.50%	0.13%	0.00%	NA
Temperate Japonica	767	99.50%	0.40%	0.13%	0.00%	NA
Tropical Japonica	504	98.00%	2.00%	0.00%	0.00%	NA
Japonica Intermediate	241	95.40%	4.60%	0.00%	0.00%	NA
VI/Aromatic	96	17.70%	82.30%	0.00%	0.00%	NA
Intermediate	90	57.80%	42.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1010652163	T -> A	LOC_Os10g21020.1	downstream_gene_variant ; 1039.0bp to feature; MODIFIER	silent_mutation	Average:49.107; most accessible tissue: Minghui63 flag leaf, score: 63.692	N	N	N	N
vg1010652163	T -> A	LOC_Os10g21000-LOC_Os10g21020	intergenic_region ; MODIFIER	silent_mutation	Average:49.107; most accessible tissue: Minghui63 flag leaf, score: 63.692	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1010652163	NA	6.21E-11	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010652163	NA	1.62E-15	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010652163	NA	3.35E-12	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010652163	NA	7.75E-12	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010652163	NA	4.93E-24	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010652163	NA	3.97E-11	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010652163	NA	1.99E-17	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010652163	7.79E-06	1.32E-15	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010652163	NA	2.90E-10	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010652163	NA	2.08E-27	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010652163	1.57E-06	1.10E-16	mr1495_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010652163	NA	2.37E-06	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010652163	NA	1.23E-14	mr1936_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010652163	NA	2.55E-06	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251