\
| Variant ID: vg1010652163 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10652163 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, A: 0.09, others allele: 0.00, population size: 254. )
CATCTGTGATTTCTAAATTGTGTTTACGCATCATTTTGACTCTCGAAATCAGCATTATTTGTTTTTACCTTTTTCTTTATAATCAATACATGATTCGTTC[T/A]
CCTTTTTTGTGCTAATTATCTGGTAGTTTGTTACTGCTCCCTGAAAGTTTCCACGTTTGTGCTACCTTAGTGAACAAGGATGGAATTCGCAATTGGTTTG
CAAACCAATTGCGAATTCCATCCTTGTTCACTAAGGTAGCACAAACGTGGAAACTTTCAGGGAGCAGTAACAAACTACCAGATAATTAGCACAAAAAAGG[A/T]
GAACGAATCATGTATTGATTATAAAGAAAAAGGTAAAAACAAATAATGCTGATTTCGAGAGTCAAAATGATGCGTAAACACAATTTAGAAATCACAGATG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.40% | 43.60% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 39.90% | 60.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 98.30% | 1.60% | 0.07% | 0.00% | NA |
| Aus | 269 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 24.50% | 75.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 29.50% | 70.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 54.90% | 45.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 40.30% | 59.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 17.70% | 82.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 42.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010652163 | T -> A | LOC_Os10g21020.1 | downstream_gene_variant ; 1039.0bp to feature; MODIFIER | silent_mutation | Average:49.107; most accessible tissue: Minghui63 flag leaf, score: 63.692 | N | N | N | N |
| vg1010652163 | T -> A | LOC_Os10g21000-LOC_Os10g21020 | intergenic_region ; MODIFIER | silent_mutation | Average:49.107; most accessible tissue: Minghui63 flag leaf, score: 63.692 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010652163 | NA | 6.21E-11 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010652163 | NA | 1.62E-15 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010652163 | NA | 3.35E-12 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010652163 | NA | 7.75E-12 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010652163 | NA | 4.93E-24 | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010652163 | NA | 3.97E-11 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010652163 | NA | 1.99E-17 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010652163 | 7.79E-06 | 1.32E-15 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010652163 | NA | 2.90E-10 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010652163 | NA | 2.08E-27 | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010652163 | 1.57E-06 | 1.10E-16 | mr1495_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010652163 | NA | 2.37E-06 | mr1496_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010652163 | NA | 1.23E-14 | mr1936_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010652163 | NA | 2.55E-06 | mr1936_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |