Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1010576466:

Variant ID: vg1010576466 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 10576466
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

CACATGAGATGTTCCAAAAACGTCTCAATATTCATCTCTAAACGATTTAATTTTGTGCTAACCTGTAAAGCGTCTTAAACTATGTCCTCAACTAATAAAG[C/T]
GTCTCAAACATCGTCCCTATTTTAATTTCATTTATAAAAAAGAGACGACTTATAGAATGACTTAAGTGAAACGTCTTAAAACAATGGTTTTGTTGTAGTG

Reverse complement sequence

CACTACAACAAAACCATTGTTTTAAGACGTTTCACTTAAGTCATTCTATAAGTCGTCTCTTTTTTATAAATGAAATTAAAATAGGGACGATGTTTGAGAC[G/A]
CTTTATTAGTTGAGGACATAGTTTAAGACGCTTTACAGGTTAGCACAAAATTAAATCGTTTAGAGATGAATATTGAGACGTTTTTGGAACATCTCATGTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	11.20%	7.50%	1.76%	79.56%	NA
All Indica	2759	0.90%	0.30%	1.99%	96.77%	NA
All Japonica	1512	32.20%	22.20%	1.19%	44.44%	NA
Aus	269	0.40%	0.00%	1.86%	97.77%	NA
Indica I	595	0.30%	0.20%	0.00%	99.50%	NA
Indica II	465	0.60%	0.60%	1.72%	96.99%	NA
Indica III	913	1.10%	0.30%	2.96%	95.62%	NA
Indica Intermediate	786	1.40%	0.10%	2.54%	95.93%	NA
Temperate Japonica	767	31.90%	33.50%	1.69%	32.86%	NA
Tropical Japonica	504	42.50%	4.80%	0.20%	52.58%	NA
Japonica Intermediate	241	11.60%	22.40%	1.66%	64.32%	NA
VI/Aromatic	96	0.00%	0.00%	1.04%	98.96%	NA
Intermediate	90	15.60%	13.30%	4.44%	66.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1010576466	C -> T	LOC_Os10g20860.1	upstream_gene_variant ; 2477.0bp to feature; MODIFIER	silent_mutation	Average:27.286; most accessible tissue: Minghui63 young leaf, score: 47.146	N	N	N	N
vg1010576466	C -> T	LOC_Os10g20870.1	upstream_gene_variant ; 926.0bp to feature; MODIFIER	silent_mutation	Average:27.286; most accessible tissue: Minghui63 young leaf, score: 47.146	N	N	N	N
vg1010576466	C -> T	LOC_Os10g20880.1	downstream_gene_variant ; 1344.0bp to feature; MODIFIER	silent_mutation	Average:27.286; most accessible tissue: Minghui63 young leaf, score: 47.146	N	N	N	N
vg1010576466	C -> T	LOC_Os10g20870-LOC_Os10g20880	intergenic_region ; MODIFIER	silent_mutation	Average:27.286; most accessible tissue: Minghui63 young leaf, score: 47.146	N	N	N	N
vg1010576466	C -> DEL	N	N	silent_mutation	Average:27.286; most accessible tissue: Minghui63 young leaf, score: 47.146	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1010576466	9.73E-06	NA	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010576466	4.01E-06	NA	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010576466	7.39E-06	NA	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010576466	NA	6.09E-07	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010576466	4.74E-07	NA	mr1959_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251