| Variant ID: vg1010576466 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10576466 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 92. )
CACATGAGATGTTCCAAAAACGTCTCAATATTCATCTCTAAACGATTTAATTTTGTGCTAACCTGTAAAGCGTCTTAAACTATGTCCTCAACTAATAAAG[C/T]
GTCTCAAACATCGTCCCTATTTTAATTTCATTTATAAAAAAGAGACGACTTATAGAATGACTTAAGTGAAACGTCTTAAAACAATGGTTTTGTTGTAGTG
CACTACAACAAAACCATTGTTTTAAGACGTTTCACTTAAGTCATTCTATAAGTCGTCTCTTTTTTATAAATGAAATTAAAATAGGGACGATGTTTGAGAC[G/A]
CTTTATTAGTTGAGGACATAGTTTAAGACGCTTTACAGGTTAGCACAAAATTAAATCGTTTAGAGATGAATATTGAGACGTTTTTGGAACATCTCATGTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 11.20% | 7.50% | 1.76% | 79.56% | NA |
| All Indica | 2759 | 0.90% | 0.30% | 1.99% | 96.77% | NA |
| All Japonica | 1512 | 32.20% | 22.20% | 1.19% | 44.44% | NA |
| Aus | 269 | 0.40% | 0.00% | 1.86% | 97.77% | NA |
| Indica I | 595 | 0.30% | 0.20% | 0.00% | 99.50% | NA |
| Indica II | 465 | 0.60% | 0.60% | 1.72% | 96.99% | NA |
| Indica III | 913 | 1.10% | 0.30% | 2.96% | 95.62% | NA |
| Indica Intermediate | 786 | 1.40% | 0.10% | 2.54% | 95.93% | NA |
| Temperate Japonica | 767 | 31.90% | 33.50% | 1.69% | 32.86% | NA |
| Tropical Japonica | 504 | 42.50% | 4.80% | 0.20% | 52.58% | NA |
| Japonica Intermediate | 241 | 11.60% | 22.40% | 1.66% | 64.32% | NA |
| VI/Aromatic | 96 | 0.00% | 0.00% | 1.04% | 98.96% | NA |
| Intermediate | 90 | 15.60% | 13.30% | 4.44% | 66.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010576466 | C -> T | LOC_Os10g20860.1 | upstream_gene_variant ; 2477.0bp to feature; MODIFIER | silent_mutation | Average:27.286; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
| vg1010576466 | C -> T | LOC_Os10g20870.1 | upstream_gene_variant ; 926.0bp to feature; MODIFIER | silent_mutation | Average:27.286; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
| vg1010576466 | C -> T | LOC_Os10g20880.1 | downstream_gene_variant ; 1344.0bp to feature; MODIFIER | silent_mutation | Average:27.286; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
| vg1010576466 | C -> T | LOC_Os10g20870-LOC_Os10g20880 | intergenic_region ; MODIFIER | silent_mutation | Average:27.286; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
| vg1010576466 | C -> DEL | N | N | silent_mutation | Average:27.286; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010576466 | 9.73E-06 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010576466 | 4.01E-06 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010576466 | 7.39E-06 | NA | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010576466 | NA | 6.09E-07 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010576466 | 4.74E-07 | NA | mr1959_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |