\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010576466:

Variant ID: vg1010576466 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10576466
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


CACATGAGATGTTCCAAAAACGTCTCAATATTCATCTCTAAACGATTTAATTTTGTGCTAACCTGTAAAGCGTCTTAAACTATGTCCTCAACTAATAAAG[C/T]
GTCTCAAACATCGTCCCTATTTTAATTTCATTTATAAAAAAGAGACGACTTATAGAATGACTTAAGTGAAACGTCTTAAAACAATGGTTTTGTTGTAGTG

Reverse complement sequence

CACTACAACAAAACCATTGTTTTAAGACGTTTCACTTAAGTCATTCTATAAGTCGTCTCTTTTTTATAAATGAAATTAAAATAGGGACGATGTTTGAGAC[G/A]
CTTTATTAGTTGAGGACATAGTTTAAGACGCTTTACAGGTTAGCACAAAATTAAATCGTTTAGAGATGAATATTGAGACGTTTTTGGAACATCTCATGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 11.20% 7.50% 1.76% 79.56% NA
All Indica  2759 0.90% 0.30% 1.99% 96.77% NA
All Japonica  1512 32.20% 22.20% 1.19% 44.44% NA
Aus  269 0.40% 0.00% 1.86% 97.77% NA
Indica I  595 0.30% 0.20% 0.00% 99.50% NA
Indica II  465 0.60% 0.60% 1.72% 96.99% NA
Indica III  913 1.10% 0.30% 2.96% 95.62% NA
Indica Intermediate  786 1.40% 0.10% 2.54% 95.93% NA
Temperate Japonica  767 31.90% 33.50% 1.69% 32.86% NA
Tropical Japonica  504 42.50% 4.80% 0.20% 52.58% NA
Japonica Intermediate  241 11.60% 22.40% 1.66% 64.32% NA
VI/Aromatic  96 0.00% 0.00% 1.04% 98.96% NA
Intermediate  90 15.60% 13.30% 4.44% 66.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010576466 C -> T LOC_Os10g20860.1 upstream_gene_variant ; 2477.0bp to feature; MODIFIER silent_mutation Average:27.286; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg1010576466 C -> T LOC_Os10g20870.1 upstream_gene_variant ; 926.0bp to feature; MODIFIER silent_mutation Average:27.286; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg1010576466 C -> T LOC_Os10g20880.1 downstream_gene_variant ; 1344.0bp to feature; MODIFIER silent_mutation Average:27.286; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg1010576466 C -> T LOC_Os10g20870-LOC_Os10g20880 intergenic_region ; MODIFIER silent_mutation Average:27.286; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg1010576466 C -> DEL N N silent_mutation Average:27.286; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010576466 9.73E-06 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010576466 4.01E-06 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010576466 7.39E-06 NA mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010576466 NA 6.09E-07 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010576466 4.74E-07 NA mr1959_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251