\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010565363:

Variant ID: vg1010565363 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10565363
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.54, A: 0.48, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


TCCGTGCTTCACATACATTTAGTTGAGCCATGTGCAAACTTCTCTTTAATCTATGTTTCTCTCTATTTTCTCTGAAAATAATAAAATAATGTCATGAGAG[A/T]
CCAGCAGCTAATTATGAGTTTTTTGTGGTGCCCTACGGCAGATGTGTGGTCTTACGGTGTCCCTCAGCTAATTATATGCTTTTTACATGTCCTGCAACAA

Reverse complement sequence

TTGTTGCAGGACATGTAAAAAGCATATAATTAGCTGAGGGACACCGTAAGACCACACATCTGCCGTAGGGCACCACAAAAAACTCATAATTAGCTGCTGG[T/A]
CTCTCATGACATTATTTTATTATTTTCAGAGAAAATAGAGAGAAACATAGATTAAAGAGAAGTTTGCACATGGCTCAACTAAATGTATGTGAAGCACGGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.20% 49.40% 0.04% 0.40% NA
All Indica  2759 22.90% 76.50% 0.04% 0.58% NA
All Japonica  1512 87.60% 12.20% 0.07% 0.07% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 4.40% 95.30% 0.00% 0.34% NA
Indica II  465 12.70% 86.20% 0.00% 1.08% NA
Indica III  913 36.80% 62.70% 0.00% 0.55% NA
Indica Intermediate  786 26.70% 72.60% 0.13% 0.51% NA
Temperate Japonica  767 85.80% 14.10% 0.13% 0.00% NA
Tropical Japonica  504 96.60% 3.40% 0.00% 0.00% NA
Japonica Intermediate  241 74.70% 24.90% 0.00% 0.41% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 63.30% 34.40% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010565363 A -> T LOC_Os10g20830.1 upstream_gene_variant ; 1522.0bp to feature; MODIFIER silent_mutation Average:40.426; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N
vg1010565363 A -> T LOC_Os10g20820.1 downstream_gene_variant ; 3552.0bp to feature; MODIFIER silent_mutation Average:40.426; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N
vg1010565363 A -> T LOC_Os10g20840.1 downstream_gene_variant ; 1055.0bp to feature; MODIFIER silent_mutation Average:40.426; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N
vg1010565363 A -> T LOC_Os10g20830-LOC_Os10g20840 intergenic_region ; MODIFIER silent_mutation Average:40.426; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N
vg1010565363 A -> DEL N N silent_mutation Average:40.426; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010565363 NA 9.58E-45 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363 5.63E-07 3.86E-17 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363 7.86E-06 2.18E-13 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363 NA 7.26E-43 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363 8.33E-07 2.22E-16 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363 NA 1.53E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363 NA 3.18E-19 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363 5.13E-06 4.01E-09 mr1261 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363 6.73E-06 NA mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363 NA 4.39E-06 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363 NA 1.02E-14 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363 NA 4.16E-15 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363 NA 2.31E-06 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363 NA 2.53E-39 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363 NA 2.47E-13 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363 9.41E-07 9.41E-07 mr1430_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363 NA 7.25E-07 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251