Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010565363:

Variant ID: vg1010565363 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 10565363
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.54, A: 0.48, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

TCCGTGCTTCACATACATTTAGTTGAGCCATGTGCAAACTTCTCTTTAATCTATGTTTCTCTCTATTTTCTCTGAAAATAATAAAATAATGTCATGAGAG[A/T]
CCAGCAGCTAATTATGAGTTTTTTGTGGTGCCCTACGGCAGATGTGTGGTCTTACGGTGTCCCTCAGCTAATTATATGCTTTTTACATGTCCTGCAACAA

Reverse complement sequence

TTGTTGCAGGACATGTAAAAAGCATATAATTAGCTGAGGGACACCGTAAGACCACACATCTGCCGTAGGGCACCACAAAAAACTCATAATTAGCTGCTGG[T/A]
CTCTCATGACATTATTTTATTATTTTCAGAGAAAATAGAGAGAAACATAGATTAAAGAGAAGTTTGCACATGGCTCAACTAAATGTATGTGAAGCACGGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.20%	49.40%	0.04%	0.40%	NA
All Indica	2759	22.90%	76.50%	0.04%	0.58%	NA
All Japonica	1512	87.60%	12.20%	0.07%	0.07%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	4.40%	95.30%	0.00%	0.34%	NA
Indica II	465	12.70%	86.20%	0.00%	1.08%	NA
Indica III	913	36.80%	62.70%	0.00%	0.55%	NA
Indica Intermediate	786	26.70%	72.60%	0.13%	0.51%	NA
Temperate Japonica	767	85.80%	14.10%	0.13%	0.00%	NA
Tropical Japonica	504	96.60%	3.40%	0.00%	0.00%	NA
Japonica Intermediate	241	74.70%	24.90%	0.00%	0.41%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	63.30%	34.40%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1010565363	A -> T	LOC_Os10g20830.1	upstream_gene_variant ; 1522.0bp to feature; MODIFIER	silent_mutation	Average:40.426; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N
vg1010565363	A -> T	LOC_Os10g20820.1	downstream_gene_variant ; 3552.0bp to feature; MODIFIER	silent_mutation	Average:40.426; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N
vg1010565363	A -> T	LOC_Os10g20840.1	downstream_gene_variant ; 1055.0bp to feature; MODIFIER	silent_mutation	Average:40.426; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N
vg1010565363	A -> T	LOC_Os10g20830-LOC_Os10g20840	intergenic_region ; MODIFIER	silent_mutation	Average:40.426; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N
vg1010565363	A -> DEL	N	N	silent_mutation	Average:40.426; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1010565363	NA	9.58E-45	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363	5.63E-07	3.86E-17	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363	7.86E-06	2.18E-13	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363	NA	7.26E-43	mr1161	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363	8.33E-07	2.22E-16	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363	NA	1.53E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363	NA	3.18E-19	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363	5.13E-06	4.01E-09	mr1261	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363	6.73E-06	NA	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363	NA	4.39E-06	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363	NA	1.02E-14	mr1531	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363	NA	4.16E-15	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363	NA	2.31E-06	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363	NA	2.53E-39	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363	NA	2.47E-13	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363	9.41E-07	9.41E-07	mr1430_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010565363	NA	7.25E-07	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251